ICEberg ID | 92 |
Name | Tn1549 |
ICEO ID | ICEO_0000177 |
Organism | Enterococcus faecalis BM4382 |
Size (bp) | 33805 |
GC content [Genome] (%) | 52.83 |
Insertion site | - |
Function | - |
Species that ICE can be transferred to | Enterococcus faecalis; Enterococcus faecium; Clostridium symbiosum |
Nucleotide Sequence | AF192329 (complete ICE sequence in this GenBank file) |
Replicon | - |
Coordinates | 1..33805 |
Putative oriT region | coordinates: 22239..22266; oriTDB id: 200002 GGGAGTGGCTACACTCCCTATGCTTGCT |
Putative relaxase | coordinates: 20529..21857; Family: MOBP |
The graph information of Tn1549 components from AF192329 | |||||
Complete gene list of Tn1549 from AF192329 | |||||
# | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
1 | - | 252..1451 [+], 1200 | unknown | ||
2 | - | 1473..1685 [+], 213 | unknown | ||
3 | - | 1760..2236 [+], 477 | unknown | ||
4 | - | 2233..3927 [+], 1695 | TrsK-like protein | T4CP | |
5 | - | 4426..5289 [+], 864 | unknown | ||
6 | - | 5320..5862 [+], 543 | MunI-like protein | ||
7 | - | 5876..6298 [+], 423 | unknown | ||
8 | - | 6228..8627 [+], 2400 | TrsE-like protein | ||
9 | - | 8659..10650 [+], 1992 | unknown | Orf14_Tn, T4SS component | |
10 | - | 10673..10924 [+], 252 | unknown | ||
11 | - | 10914..12143 [+], 1230 | bacteriocin-like protein | ||
12 | - | 12140..14221 [+], 2082 | DNA topoisomerase III-like protein | ||
13 | - | 14370..18290 [+], 3921 | LtrC-like protein | ||
14 | - | 18291..19235 [+], 945 | unknown | ||
15 | - | 19742..20188 [-], 447 | unknown | ||
16 | - | 20529..21857 [-], 1329 | Rlx-like protein | Relaxase, MOBP Family | |
17 | - | 21818..22147 [-], 330 | unknown | ||
18 | - | 22405..22776 [-], 372 | unknown | ||
19 | vanRB | 24047..24709 [+], 663 | VanRB | AR | |
20 | vanSB | 24709..26052 [+], 1344 | VanSB | AR | |
21 | vanYB | 26223..27029 [+], 807 | VanYB | AR | |
22 | vanW | 27047..27874 [+], 828 | VanW | AR | |
23 | vanHB | 27871..28842 [+], 972 | VanHB | AR | |
24 | vanB | 28835..29863 [+], 1029 | VanB | AR | |
25 | vanXB | 29869..30477 [+], 609 | VanXB | AR | |
26 | - | 31063..31494 [+], 432 | unknown | ||
27 | - | 31501..31731 [+], 231 | unknown | ||
28 | xis | 32148..32348 [+], 201 | excisionase | ||
29 | int | 32432..33625 [+], 1194 | integrase | Integrase |
Gene may contribute to site-specific recombination |
(1) Foucault ML; Depardieu F; Courvalin P; Grillot-Courvalin C (2010). Inducible expression eliminates the fitness cost of vancomycin resistance in enterococci. Proc Natl Acad Sci U S A. 107(39):16964-9. [PubMed:20833818] |
(2) Tsvetkova K; Marvaud JC; Lambert T (2010). Analysis of the mobilization functions of the vancomycin resistance transposon Tn1549, a member of a new family of conjugative elements. J Bacteriol. 192(3):702-13. [PubMed:19966009] |
(3) Garnier F; Taourit S; Glaser P; Courvalin P; Galimand M (2000). Characterization of transposon Tn1549, conferring VanB-type resistance in Enterococcus spp. Microbiology. 146 ( Pt 6):1481-9. [PubMed:10846226] |
experimental literature |