ICEberg
I. Information of ICE
ICEberg ID88
Name ICESpn11876 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae 11876
Size (bp)71516
GC content [Genome] (%)35.3
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceFR671404 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..71516 
Putative oriT region coordinates: 37573..37705;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase coordinates: 36300..37562; Gene: orf20;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpn11876 is not available.



The graph information of ICESpn11876 components from FR671404
Complete gene list of ICESpn11876 from FR671404
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-168..1355 [-], 1188integrase
2-1327..1635 [-], 309conserved hypothetical protein
3-2690..2851 [-], 162Hypothetical protein
4-3644..4825 [-], 1182MFS transporter
5-4848..5342 [-], 495Putative CoA-depedent acetyltransferase
6-5363..5506 [+], 144Membrane protein
7-6090..6386 [-], 297ABC transporter, ATPase subunit
8-6571..6699 [-], 129Membrane protein
9-6879..8702 [-], 1824Tn5252 relaxase
10-8689..9054 [-], 366Tn5252 orf9 protein
11-9059..9403 [-], 345Tn5252 orf10 protein
12-9791..10285 [-], 495Conserved hypothetical protein
13-10406..10546 [+], 141Transposase fragment (pseudogene)
14-10705..10848 [-], 144Conserved hypothetical protein
15-10923..11555 [-], 633Conserved hypothetical protein
16-11637..11912 [-], 276putative uncharacterized protein
17-11950..12333 [-], 384putative uncharacterized protein
18-12330..12563 [-], 234putative uncharacterized protein
19-12614..13699 [-], 1086putative uncharacterized protein
20-13709..14350 [-], 642putative uncharacterized proteinPrgL, T4SS component 
21-15513..16421 [+], 909Putative helix-turn-helix DNA binding protein
22-16374..40692 [-], 24319Metalloprotease (pseudogene)
23-17228..18445 [-], 1218putative integraseIntegrase 
24xis18527..18730 [-], 204excisionase
25orf719418..19840 [-], 423putative conjugative transposon regulatory protein
26-20069..20215 [-], 147putative uncharacterized protein
27orf920345..20698 [+], 354putative conjugative transposon regulatory protein
28tetM21044..22978 [-], 1935conjugative transposon tetracycline resistance protein
29orf1323215..24150 [-], 936putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
30orf1424147..25148 [-], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
31orf1525145..27256 [-], 2112conjugative transposon membrane proteinOrf15_Tn, T4SS component 
32orf1627325..29649 [-], 2325conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
33orf1729756..29986 [-], 231putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
34orf1830237..30734 [-], 498conjugative transposon protein
35orf1930851..31072 [-], 222conjugative transposon proteinOrf19_Tn, T4SS component 
36-31252..32499 [+], 1248Transposase
37ermB32756..33493 [-], 738rRNA methylase
38-33722..33991 [-], 270Omega transcriptional repressor
39-34147..34296 [-], 150Conserved hypothetical protein
40-34323..34893 [-], 571Putative helix-turn-helix DNA binding protein (pseudogene)
41-35169..35963 [-], 795Aminoglycoside phosphotransferase
42-36056..36277 [-], 222Omega transcriptional regulator
43orf2036300..37562 [-], 1263putative conjugative transposon replication initiation factorRelaxase, MOBT Family
44orf2137740..39125 [-], 1386conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
45orf2239154..39540 [-], 387conjugative transposon protein
46orf2339556..39843 [-], 288conjugative transposon protein
47-40685..41806 [-], 1122HesA/MoeB/ThiF domain protein
48-42258..43652 [-], 1395ABC transporter, ATPase subunit
49-44045..44341 [-], 297Membrane protein
50-44355..44639 [-], 285putative uncharacterized protein
51-44714..50959 [-], 6246putative conjugative transposon DNA recombination protein
52-50992..51402 [-], 411putative uncharacterized protein (pseudogene)
53-51553..52137 [-], 585putative uncharacterized protein
54-52375..55188 [-], 2814putative conjugal transfer proteinPrgK, T4SS component 
55-55200..57557 [-], 2358putative conjugal transfer proteinPrgJ, T4SS component 
56-57508..57867 [-], 360putative uncharacterized protein
57-57921..58775 [-], 855putative uncharacterized proteinPrgH, T4SS component 
58-58792..59034 [-], 243putative uncharacterized protein
59traG59055..60932 [-], 1878putative conjugal transfer protein TraG
60-60932..61396 [-], 465putative uncharacterized protein
61-61410..61709 [-], 300putative uncharacterized protein
62-62303..62935 [-], 633ABC efflux transporter, ATPase subunit
63-62937..64946 [-], 2010ABC efflux transporter permease subunit
64-65008..65304 [-], 297Bacteriocin
65-65601..66053 [-], 453conserved hypothetical protein
66-66407..67042 [-], 636Conserved hypothetical protein
67-67332..67919 [-], 588putative CAAX amino terminal protease
68-67922..68155 [-], 234putative uncharacterized protein
69-68168..68548 [-], 381putative uncharacterized protein
70-68541..68990 [-], 450putative uncharacterized protein
71-68974..70332 [-], 1359putative DNA methylase
72-70431..71210 [-], 780putative replication initiator protein
73-71207..71419 [-], 213putative uncharacterized protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins69Fasta
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU