![]() | 88 |
![]() ![]() | ICESpn11876 ![]() |
![]() | Streptococcus pneumoniae 11876 |
![]() | 71516 |
![]() | 35.3 |
![]() | - |
![]() | - |
![]() | - |
![]() | FR671404 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..71516 |
![]() ![]() | coordinates: 37573..37705; oriTDB id: 200001 GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT |
![]() ![]() | coordinates: 36300..37562; Gene: orf20; Family: MOBT |
The graph information of ICESpn11876 components from FR671404 | |||||
![]() | |||||
Complete gene list of ICESpn11876 from FR671404 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 168..1355 [-], 1188 | integrase | ||
2 | - | 1327..1635 [-], 309 | conserved hypothetical protein | ||
3 | - | 2690..2851 [-], 162 | Hypothetical protein | ||
4 | - | 3644..4825 [-], 1182 | MFS transporter | ||
5 | - | 4848..5342 [-], 495 | Putative CoA-depedent acetyltransferase | ||
6 | - | 5363..5506 [+], 144 | Membrane protein | ||
7 | - | 6090..6386 [-], 297 | ABC transporter, ATPase subunit | ||
8 | - | 6571..6699 [-], 129 | Membrane protein | ||
9 | - | 6879..8702 [-], 1824 | Tn5252 relaxase | ||
10 | - | 8689..9054 [-], 366 | Tn5252 orf9 protein | ||
11 | - | 9059..9403 [-], 345 | Tn5252 orf10 protein | ||
12 | - | 9791..10285 [-], 495 | Conserved hypothetical protein | ||
13 | - | 10406..10546 [+], 141 | Transposase fragment (pseudogene) | ||
14 | - | 10705..10848 [-], 144 | Conserved hypothetical protein | ||
15 | - | 10923..11555 [-], 633 | Conserved hypothetical protein | ||
16 | - | 11637..11912 [-], 276 | putative uncharacterized protein | ||
17 | - | 11950..12333 [-], 384 | putative uncharacterized protein | ||
18 | - | 12330..12563 [-], 234 | putative uncharacterized protein | ||
19 | - | 12614..13699 [-], 1086 | putative uncharacterized protein | ||
20 | - | 13709..14350 [-], 642 | putative uncharacterized protein | PrgL, T4SS component | |
21 | - | 15513..16421 [+], 909 | Putative helix-turn-helix DNA binding protein | ||
22 | - | 16374..40692 [-], 24319 | Metalloprotease (pseudogene) | ||
23 | - | 17228..18445 [-], 1218 | putative integrase | Integrase | |
24 | xis | 18527..18730 [-], 204 | excisionase | ||
25 | orf7 | 19418..19840 [-], 423 | putative conjugative transposon regulatory protein | ||
26 | - | 20069..20215 [-], 147 | putative uncharacterized protein | ||
27 | orf9 | 20345..20698 [+], 354 | putative conjugative transposon regulatory protein | ||
28 | tetM | 21044..22978 [-], 1935 | conjugative transposon tetracycline resistance protein | ||
29 | orf13 | 23215..24150 [-], 936 | putative conjugative transposon exported protein | Orf13_Tn, T4SS component | |
30 | orf14 | 24147..25148 [-], 1002 | putative cell wall hydrolase | Orf14_Tn, T4SS component | |
31 | orf15 | 25145..27256 [-], 2112 | conjugative transposon membrane protein | Orf15_Tn, T4SS component | |
32 | orf16 | 27325..29649 [-], 2325 | conjugative transposon ATP/GTP-binding protein | Orf16_Tn, T4SS component | |
33 | orf17 | 29756..29986 [-], 231 | putative conjugative transposon membrane protein | Orf17_Tn, T4SS component | |
34 | orf18 | 30237..30734 [-], 498 | conjugative transposon protein | ||
35 | orf19 | 30851..31072 [-], 222 | conjugative transposon protein | Orf19_Tn, T4SS component | |
36 | - | 31252..32499 [+], 1248 | Transposase | ||
37 | ermB | 32756..33493 [-], 738 | rRNA methylase | ||
38 | - | 33722..33991 [-], 270 | Omega transcriptional repressor | ||
39 | - | 34147..34296 [-], 150 | Conserved hypothetical protein | ||
40 | - | 34323..34893 [-], 571 | Putative helix-turn-helix DNA binding protein (pseudogene) | ||
41 | - | 35169..35963 [-], 795 | Aminoglycoside phosphotransferase | ||
42 | - | 36056..36277 [-], 222 | Omega transcriptional regulator | ||
43 | orf20 | 36300..37562 [-], 1263 | putative conjugative transposon replication initiation factor | Relaxase, MOBT Family | |
44 | orf21 | 37740..39125 [-], 1386 | conjugative transposon FtsK/SpoIIIE-family protein | Orf21_Tn, T4SS component | |
45 | orf22 | 39154..39540 [-], 387 | conjugative transposon protein | ||
46 | orf23 | 39556..39843 [-], 288 | conjugative transposon protein | ||
47 | - | 40685..41806 [-], 1122 | HesA/MoeB/ThiF domain protein | ||
48 | - | 42258..43652 [-], 1395 | ABC transporter, ATPase subunit | ||
49 | - | 44045..44341 [-], 297 | Membrane protein | ||
50 | - | 44355..44639 [-], 285 | putative uncharacterized protein | ||
51 | - | 44714..50959 [-], 6246 | putative conjugative transposon DNA recombination protein | ||
52 | - | 50992..51402 [-], 411 | putative uncharacterized protein (pseudogene) | ||
53 | - | 51553..52137 [-], 585 | putative uncharacterized protein | ||
54 | - | 52375..55188 [-], 2814 | putative conjugal transfer protein | PrgK, T4SS component | |
55 | - | 55200..57557 [-], 2358 | putative conjugal transfer protein | PrgJ, T4SS component | |
56 | - | 57508..57867 [-], 360 | putative uncharacterized protein | ||
57 | - | 57921..58775 [-], 855 | putative uncharacterized protein | PrgH, T4SS component | |
58 | - | 58792..59034 [-], 243 | putative uncharacterized protein | ||
59 | traG | 59055..60932 [-], 1878 | putative conjugal transfer protein TraG | ||
60 | - | 60932..61396 [-], 465 | putative uncharacterized protein | ||
61 | - | 61410..61709 [-], 300 | putative uncharacterized protein | ||
62 | - | 62303..62935 [-], 633 | ABC efflux transporter, ATPase subunit | ||
63 | - | 62937..64946 [-], 2010 | ABC efflux transporter permease subunit | ||
64 | - | 65008..65304 [-], 297 | Bacteriocin | ||
65 | - | 65601..66053 [-], 453 | conserved hypothetical protein | ||
66 | - | 66407..67042 [-], 636 | Conserved hypothetical protein | ||
67 | - | 67332..67919 [-], 588 | putative CAAX amino terminal protease | ||
68 | - | 67922..68155 [-], 234 | putative uncharacterized protein | ||
69 | - | 68168..68548 [-], 381 | putative uncharacterized protein | ||
70 | - | 68541..68990 [-], 450 | putative uncharacterized protein | ||
71 | - | 68974..70332 [-], 1359 | putative DNA methylase | ||
72 | - | 70431..71210 [-], 780 | putative replication initiator protein | ||
73 | - | 71207..71419 [-], 213 | putative uncharacterized protein |
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] ![]() |
![]() |