ICEberg
I. Information of ICE
ICEberg ID87
Name ICESpn9409 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae 9409
Size (bp)22765
GC content [Genome] (%)38.43
Insertion site-
FunctionTetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceFR671418 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..22765 
Putative oriT region coordinates: 2166..2298;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTAAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2309..3571; Gene: orf20;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpn9409 is not available.



The graph information of ICESpn9409 components from FR671418
Complete gene list of ICESpn9409 from FR671418
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1orf231..315 [+], 315conjugative transposon protein
2orf22334..717 [+], 384conjugative transposon protein
3orf21746..2131 [+], 1386conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
4orf202309..3571 [+], 1263putative conjugative transposon replication initiation factorRelaxase, MOBT Family
5-3561..3815 [+], 255Omega transcriptional repressor protein
6aph3908..4702 [+], 795Aminoglycoside phosphotransferase
7-5186..5551 [+], 366Conserved hypothetical protein
8-5575..5724 [+], 150Conserved hypothetical protein
9-5880..6149 [+], 270Omega transcriptional repressor protein
10ermB6379..7116 [+], 738rRNA methylase
11-7373..8620 [-], 1248Transposase
12orf198800..9021 [+], 222conjugative transposon proteinOrf19_Tn, T4SS component 
13orf189138..9635 [+], 498conjugative transposon protein
14orf179886..10116 [+], 231putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
15orf1610100..12547 [+], 2448conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
16orf1512550..14727 [+], 2178conjugative transposon membrane proteinOrf15_Tn, T4SS component 
17orf1414724..15725 [+], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
18orf1315740..16654 [+], 915putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
19tetM17031..18950 [+], 1920conjugative transposon tetracycline resistance protein
20orf919296..19649 [-], 354putative conjugative transposon regulatory protein
21SPN23F1306119779..19925 [+], 147putative uncharacterized protein
22orf720154..20576 [+], 423putative conjugative transposon regulatory protein
23xis21264..21467 [+], 204excisionase
24int21549..22765 [+], 1217putative integrase (pseudogene)Integrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins24Fasta
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU