![]() | 87 |
![]() ![]() | ICESpn9409 ![]() |
![]() | Streptococcus pneumoniae 9409 |
![]() | 22765 |
![]() | 38.43 |
![]() | - |
![]() | Tetracycline resistance |
![]() | - |
![]() | FR671418 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..22765 |
![]() ![]() | coordinates: 2166..2298; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTAAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 2309..3571; Gene: orf20; Family: MOBT |
The graph information of ICESpn9409 components from FR671418 | |||||
![]() | |||||
Complete gene list of ICESpn9409 from FR671418 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | orf23 | 1..315 [+], 315 | conjugative transposon protein | ||
2 | orf22 | 334..717 [+], 384 | conjugative transposon protein | ||
3 | orf21 | 746..2131 [+], 1386 | conjugative transposon FtsK/SpoIIIE-family protein | Orf21_Tn, T4SS component | |
4 | orf20 | 2309..3571 [+], 1263 | putative conjugative transposon replication initiation factor | Relaxase, MOBT Family | |
5 | - | 3561..3815 [+], 255 | Omega transcriptional repressor protein | ||
6 | aph | 3908..4702 [+], 795 | Aminoglycoside phosphotransferase | ||
7 | - | 5186..5551 [+], 366 | Conserved hypothetical protein | ||
8 | - | 5575..5724 [+], 150 | Conserved hypothetical protein | ||
9 | - | 5880..6149 [+], 270 | Omega transcriptional repressor protein | ||
10 | ermB | 6379..7116 [+], 738 | rRNA methylase | ||
11 | - | 7373..8620 [-], 1248 | Transposase | ||
12 | orf19 | 8800..9021 [+], 222 | conjugative transposon protein | Orf19_Tn, T4SS component | |
13 | orf18 | 9138..9635 [+], 498 | conjugative transposon protein | ||
14 | orf17 | 9886..10116 [+], 231 | putative conjugative transposon membrane protein | Orf17_Tn, T4SS component | |
15 | orf16 | 10100..12547 [+], 2448 | conjugative transposon ATP/GTP-binding protein | Orf16_Tn, T4SS component | |
16 | orf15 | 12550..14727 [+], 2178 | conjugative transposon membrane protein | Orf15_Tn, T4SS component | |
17 | orf14 | 14724..15725 [+], 1002 | putative cell wall hydrolase | Orf14_Tn, T4SS component | |
18 | orf13 | 15740..16654 [+], 915 | putative conjugative transposon exported protein | Orf13_Tn, T4SS component | |
19 | tetM | 17031..18950 [+], 1920 | conjugative transposon tetracycline resistance protein | ||
20 | orf9 | 19296..19649 [-], 354 | putative conjugative transposon regulatory protein | ||
21 | SPN23F13061 | 19779..19925 [+], 147 | putative uncharacterized protein | ||
22 | orf7 | 20154..20576 [+], 423 | putative conjugative transposon regulatory protein | ||
23 | xis | 21264..21467 [+], 204 | excisionase | ||
24 | int | 21549..22765 [+], 1217 | putative integrase (pseudogene) | Integrase |
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] ![]() |
![]() |