![]() | 862 |
![]() ![]() | Tn6198 ![]() |
![]() ![]() | ICEO_0000360 |
![]() | Listeria monocytogenes TTH-2007 |
![]() | 21322 |
![]() | 37.93 |
![]() | - |
![]() | Antibiotic resistance genes: tet(M) , dfrG |
![]() | - |
![]() | JX120102 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..21322 |
![]() ![]() | coordinates: 5792..5924; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 6151..7140; Family: MOBT |
The graph information of Tn6198 components from JX120102 | |||||
![]() | |||||
Complete gene list of Tn6198 from JX120102 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 200..319 [+], 120 | hypothetical protein | ||
2 | - | 578..814 [+], 237 | hypothetical protein | ||
3 | - | 821..2773 [+], 1953 | hypothetical protein | ||
4 | - | 2845..3342 [-], 498 | dihydrofolate reductase | ||
5 | - | 3627..3941 [+], 315 | hypothetical protein | ||
6 | - | 3957..4343 [+], 387 | hypothetical protein | ||
7 | - | 4372..5757 [+], 1386 | hypothetical protein | Orf21_Tn, T4SS component | |
8 | - | 6151..7140 [+], 990 | hypothetical protein | Relaxase, MOBT Family | |
9 | - | 7183..7404 [+], 222 | hypothetical protein | Orf19_Tn, T4SS component | |
10 | - | 7521..8018 [+], 498 | hypothetical protein | ||
11 | - | 7993..8499 [+], 507 | hypothetical protein | Orf17_Tn, T4SS component | |
12 | - | 8483..10930 [+], 2448 | hypothetical protein | Orf16_Tn, T4SS component | |
13 | - | 10933..13197 [+], 2265 | hypothetical protein | Orf15_Tn, T4SS component | |
14 | - | 13106..14107 [+], 1002 | hypothetical protein | Orf14_Tn, T4SS component | |
15 | - | 14104..15036 [+], 933 | hypothetical protein | Orf13_Tn, T4SS component | |
16 | - | 15311..15397 [+], 87 | tet(M) leader peptide | ||
17 | - | 15413..17332 [+], 1920 | tetracycline resistance | AR | |
18 | - | 17430..17618 [+], 189 | hypothetical protein | ||
19 | - | 17678..18031 [-], 354 | hypothetical protein | ||
20 | - | 18236..18307 [+], 72 | hypothetical protein | ||
21 | - | 18485..18958 [+], 474 | hypothetical protein | ||
22 | - | 18955..19185 [+], 231 | hypothetical protein | ||
23 | - | 19411..19662 [-], 252 | hypothetical protein | ||
24 | - | 19646..19849 [+], 204 | excisionase | ||
25 | - | 19931..21148 [+], 1218 | integrase | ||
26 | - | 20063..21148 [+], 1086 | integrase | ||
27 | - | 20174..21148 [+], 975 | integrase | Integrase |
(1) Bertsch D; Uruty A; Anderegg J; Lacroix C; Perreten V; Meile L (2013). Tn6198, a novel transposon containing the trimethoprim resistance gene dfrG embedded into a Tn916 element in Listeria monocytogenes. J Antimicrob Chemother. 68(5):986-91. [PubMed:23344576] |