ICEberg
I. Information of ICE
ICEberg ID862
Name Tn6198 This ICE is derived from experimental literature
ICEO ID ICEO_0000360
OrganismListeria monocytogenes TTH-2007
Size (bp)21322
GC content [Genome] (%)37.93
Insertion site-
FunctionAntibiotic resistance genes: tet(M) , dfrG
Species that ICE can be transferred to-
Nucleotide SequenceJX120102 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..21322 
Putative oriT region coordinates: 5792..5924;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 6151..7140;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of Tn6198 is not available.



The graph information of Tn6198 components from JX120102
Complete gene list of Tn6198 from JX120102
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-200..319 [+], 120hypothetical protein
2-578..814 [+], 237hypothetical protein
3-821..2773 [+], 1953hypothetical protein
4-2845..3342 [-], 498dihydrofolate reductase
5-3627..3941 [+], 315hypothetical protein
6-3957..4343 [+], 387hypothetical protein
7-4372..5757 [+], 1386hypothetical proteinOrf21_Tn, T4SS component 
8-6151..7140 [+], 990hypothetical proteinRelaxase, MOBT Family
9-7183..7404 [+], 222hypothetical proteinOrf19_Tn, T4SS component 
10-7521..8018 [+], 498hypothetical protein
11-7993..8499 [+], 507hypothetical proteinOrf17_Tn, T4SS component 
12-8483..10930 [+], 2448hypothetical proteinOrf16_Tn, T4SS component 
13-10933..13197 [+], 2265hypothetical proteinOrf15_Tn, T4SS component 
14-13106..14107 [+], 1002hypothetical proteinOrf14_Tn, T4SS component 
15-14104..15036 [+], 933hypothetical proteinOrf13_Tn, T4SS component 
16-15311..15397 [+], 87tet(M) leader peptide
17-15413..17332 [+], 1920tetracycline resistanceAR 
18-17430..17618 [+], 189hypothetical protein
19-17678..18031 [-], 354hypothetical protein
20-18236..18307 [+], 72hypothetical protein
21-18485..18958 [+], 474hypothetical protein
22-18955..19185 [+], 231hypothetical protein
23-19411..19662 [-], 252hypothetical protein
24-19646..19849 [+], 204excisionase
25-19931..21148 [+], 1218integrase
26-20063..21148 [+], 1086integrase
27-20174..21148 [+], 975integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins27Fasta
(1) Bertsch D; Uruty A; Anderegg J; Lacroix C; Perreten V; Meile L (2013). Tn6198, a novel transposon containing the trimethoprim resistance gene dfrG embedded into a Tn916 element in Listeria monocytogenes. J Antimicrob Chemother. 68(5):986-91. [PubMed:23344576]