ICEberg
I. Information of ICE
ICEberg ID86
Name ICESpn11928 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae 11928
Size (bp)22793
GC content [Genome] (%)37.95
Insertion site-
FunctionTetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceFR671417 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..22793 
Putative oriT region coordinates: 2166..2298;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2309..3514; Gene: orf20;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpn11928 is not available.



The graph information of ICESpn11928 components from FR671417
Complete gene list of ICESpn11928 from FR671417
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1orf231..315 [+], 315conjugative transposon protein
2orf22331..717 [+], 387conjugative transposon protein
3orf21746..2131 [+], 1386conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
4orf202309..3514 [+], 1206putative conjugative transposon replication initiation factorRelaxase, MOBT Family
5orf193557..3778 [+], 222conjugative transposon proteinOrf19_Tn, T4SS component 
6orf183895..4392 [+], 498conjugative transposon protein
7orf174367..4873 [+], 507putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
8orf164857..7304 [+], 2448conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
9orf157307..9484 [+], 2178conjugative transposon membrane proteinOrf15_Tn, T4SS component 
10orf149481..10482 [+], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
11orf1310479..11411 [+], 933putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
12tetM11773..13707 [+], 1935conjugative transposon tetracycline resistance protein
13orf914053..19677 [-], 5625putative conjugative transposon regulatory protein (pseudogene)
14ermB14814..15551 [+], 738rRNA methylase
15tnpR15906..16460 [+], 555Resolvase
16-16464..19382 [+], 2919Transposase
17orf720182..20604 [+], 423putative conjugative transposon regulatory protein
18xis21292..21495 [+], 204excisionase
19int21577..22793 [+], 1217putative integrase (pseudogene)Integrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins18Fasta
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU