![]() | 86 |
![]() ![]() | ICESpn11928 ![]() |
![]() | Streptococcus pneumoniae 11928 |
![]() | 22793 |
![]() | 37.95 |
![]() | - |
![]() | Tetracycline resistance |
![]() | - |
![]() | FR671417 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..22793 |
![]() ![]() | coordinates: 2166..2298; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 2309..3514; Gene: orf20; Family: MOBT |
The graph information of ICESpn11928 components from FR671417 | |||||
![]() | |||||
Complete gene list of ICESpn11928 from FR671417 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | orf23 | 1..315 [+], 315 | conjugative transposon protein | ||
2 | orf22 | 331..717 [+], 387 | conjugative transposon protein | ||
3 | orf21 | 746..2131 [+], 1386 | conjugative transposon FtsK/SpoIIIE-family protein | Orf21_Tn, T4SS component | |
4 | orf20 | 2309..3514 [+], 1206 | putative conjugative transposon replication initiation factor | Relaxase, MOBT Family | |
5 | orf19 | 3557..3778 [+], 222 | conjugative transposon protein | Orf19_Tn, T4SS component | |
6 | orf18 | 3895..4392 [+], 498 | conjugative transposon protein | ||
7 | orf17 | 4367..4873 [+], 507 | putative conjugative transposon membrane protein | Orf17_Tn, T4SS component | |
8 | orf16 | 4857..7304 [+], 2448 | conjugative transposon ATP/GTP-binding protein | Orf16_Tn, T4SS component | |
9 | orf15 | 7307..9484 [+], 2178 | conjugative transposon membrane protein | Orf15_Tn, T4SS component | |
10 | orf14 | 9481..10482 [+], 1002 | putative cell wall hydrolase | Orf14_Tn, T4SS component | |
11 | orf13 | 10479..11411 [+], 933 | putative conjugative transposon exported protein | Orf13_Tn, T4SS component | |
12 | tetM | 11773..13707 [+], 1935 | conjugative transposon tetracycline resistance protein | ||
13 | orf9 | 14053..19677 [-], 5625 | putative conjugative transposon regulatory protein (pseudogene) | ||
14 | ermB | 14814..15551 [+], 738 | rRNA methylase | ||
15 | tnpR | 15906..16460 [+], 555 | Resolvase | ||
16 | - | 16464..19382 [+], 2919 | Transposase | ||
17 | orf7 | 20182..20604 [+], 423 | putative conjugative transposon regulatory protein | ||
18 | xis | 21292..21495 [+], 204 | excisionase | ||
19 | int | 21577..22793 [+], 1217 | putative integrase (pseudogene) | Integrase |
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] ![]() |
![]() |