![]() | 855 |
![]() ![]() | Tn1549-Like ![]() |
![]() | Clostridium difficile AI0499 |
![]() | 42375 |
![]() | 51.13 |
![]() | - |
![]() | Antibiotic resistance genes: tet(M), dfrG |
![]() | - |
![]() | KU558763 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..42375 |
![]() ![]() | coordinates: 27107..27134; oriTDB id: 200002 GGGAGTGGCTACACTCCCTATGCTTGCT |
![]() ![]() | coordinates: 22898..23875; Family: MOBP |
The graph information of Tn1549-Like components from KU558763 | |||||
![]() | |||||
Complete gene list of Tn1549-Like from KU558763 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 242..1441 [+], 1200 | putative conjugative transposon protein-like protein | ||
2 | - | 1463..1675 [+], 213 | hypothetical protein | ||
3 | - | 1750..2226 [+], 477 | hypothetical protein | ||
4 | - | 2223..2894 [+], 672 | hypothetical protein | T4CP | |
5 | - | 3476..5140 [+], 1665 | group II intron reverse transcriptase/maturase | ||
6 | - | 5137..6411 [+], 1275 | putative conjugative transfer protein-like protein | ||
7 | - | 6837..7658 [+], 822 | putative membrane protein-like protein | ||
8 | - | 7689..8231 [+], 543 | MunI-like protein | ||
9 | - | 8245..8667 [+], 423 | hypothetical protein | ||
10 | - | 8597..10996 [+], 2400 | putative hydrolase-like protein | ||
11 | - | 11028..13019 [+], 1992 | putative conjugative transposon protein-like protein | Orf14_Tn, T4SS component | |
12 | - | 13042..13293 [+], 252 | hypothetical protein | ||
13 | - | 13283..14512 [+], 1230 | putative cell surface protein-like protein | ||
14 | topB | 14509..16590 [+], 2082 | DNA topoisomerase III-like protein | ||
15 | - | 16739..20659 [+], 3921 | putative antirestriction protein-like protein | ||
16 | - | 20660..21604 [+], 945 | hypothetical protein | ||
17 | - | 22111..22500 [-], 390 | putative conjugative transposon protein-like protein | ||
18 | - | 22530..22901 [-], 372 | hypothetical protein | ||
19 | - | 22898..23875 [-], 978 | putative endonuclease relaxase-like protein | Relaxase, MOBP Family | |
20 | - | 24019..25821 [-], 1803 | reverse transcriptase/maturase/endonuclease | ||
21 | - | 26686..27015 [-], 330 | hypothetical protein | ||
22 | - | 27273..27644 [-], 372 | putative conjugative transposon regulatory protein | ||
23 | - | 29080..30111 [-], 1032 | amidohydrolase | ||
24 | bm3R1 | 30301..30882 [+], 582 | HTH-type transcriptional repressor | ||
25 | vanSB | 31598..32941 [+], 1344 | vancomycin resistance protein | AR | |
26 | vanYB | 33117..33923 [+], 807 | vancomycin resistance protein | AR | |
27 | vanW | 33941..34768 [+], 828 | vancomycin resistance protein | AR | |
28 | vanHB | 34765..35736 [+], 972 | vancomycin resistance protein | AR | |
29 | vanB | 35729..36757 [+], 1029 | vancomycin resistance protein | AR | |
30 | vanXB | 36763..37371 [+], 609 | vancomycin resistance protein | AR | |
31 | - | 37623..38324 [-], 702 | hypothetical protein | ||
32 | - | 38510..39193 [-], 684 | hypothetical protein | ||
33 | - | 39639..40070 [+], 432 | hypothetical protein | ||
34 | - | 40077..40310 [+], 234 | hypothetical protein | ||
35 | xis | 40734..40934 [+], 201 | excisionase | ||
36 | int | 41018..42211 [+], 1194 | integrase | Integrase |
(1) Knight DR; Androga GO; Ballard SA; Howden BP; Riley TV (2016). A Phenotypically Silent vanB2 Operon Carried on a Tn1549-Like Element in Clostridium difficile. mSphere. 1(4). [PubMed:27536735] |