ICEberg
I. Information of ICE
ICEberg ID855
Name Tn1549-Like This is a predicted ICE derived from literature
OrganismClostridium difficile AI0499
Size (bp)42375
GC content [Genome] (%)51.13
Insertion site-
FunctionAntibiotic resistance genes: tet(M), dfrG
Species that ICE can be transferred to-
Nucleotide SequenceKU558763 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..42375 
Putative oriT region coordinates: 27107..27134;   oriTDB id:  200002
GGGAGTGGCTACACTCCCTATGCTTGCT
Putative relaxase coordinates: 22898..23875;   Family:  MOBP


II. ICE interaction with IME/CIME/

The interaction information of Tn1549-Like is not available.



The graph information of Tn1549-Like components from KU558763
Complete gene list of Tn1549-Like from KU558763
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-242..1441 [+], 1200putative conjugative transposon protein-like protein
2-1463..1675 [+], 213hypothetical protein
3-1750..2226 [+], 477hypothetical protein
4-2223..2894 [+], 672hypothetical proteinT4CP 
5-3476..5140 [+], 1665group II intron reverse transcriptase/maturase
6-5137..6411 [+], 1275putative conjugative transfer protein-like protein
7-6837..7658 [+], 822putative membrane protein-like protein
8-7689..8231 [+], 543MunI-like protein
9-8245..8667 [+], 423hypothetical protein
10-8597..10996 [+], 2400putative hydrolase-like protein
11-11028..13019 [+], 1992putative conjugative transposon protein-like proteinOrf14_Tn, T4SS component 
12-13042..13293 [+], 252hypothetical protein
13-13283..14512 [+], 1230putative cell surface protein-like protein
14topB14509..16590 [+], 2082DNA topoisomerase III-like protein
15-16739..20659 [+], 3921putative antirestriction protein-like protein
16-20660..21604 [+], 945hypothetical protein
17-22111..22500 [-], 390putative conjugative transposon protein-like protein
18-22530..22901 [-], 372hypothetical protein
19-22898..23875 [-], 978putative endonuclease relaxase-like proteinRelaxase, MOBP Family
20-24019..25821 [-], 1803reverse transcriptase/maturase/endonuclease
21-26686..27015 [-], 330hypothetical protein
22-27273..27644 [-], 372putative conjugative transposon regulatory protein
23-29080..30111 [-], 1032amidohydrolase
24bm3R130301..30882 [+], 582HTH-type transcriptional repressor
25vanSB31598..32941 [+], 1344vancomycin resistance proteinAR 
26vanYB33117..33923 [+], 807vancomycin resistance proteinAR 
27vanW33941..34768 [+], 828vancomycin resistance proteinAR 
28vanHB34765..35736 [+], 972vancomycin resistance proteinAR 
29vanB35729..36757 [+], 1029vancomycin resistance proteinAR 
30vanXB36763..37371 [+], 609vancomycin resistance proteinAR 
31-37623..38324 [-], 702hypothetical protein
32-38510..39193 [-], 684hypothetical protein
33-39639..40070 [+], 432hypothetical protein
34-40077..40310 [+], 234hypothetical protein
35xis40734..40934 [+], 201excisionase
36int41018..42211 [+], 1194integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins36Fasta
(1) Knight DR; Androga GO; Ballard SA; Howden BP; Riley TV (2016). A Phenotypically Silent vanB2 Operon Carried on a Tn1549-Like Element in Clostridium difficile. mSphere. 1(4). [PubMed:27536735]