ICEberg
I. Information of ICE
ICEberg ID84
Name ICESpn11930 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae 11930
Size (bp)73716
GC content [Genome] (%)35.4
Insertion site-
FunctionTetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceFR671403 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..73716 
Putative oriT region coordinates: 55335..55467;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTATAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase coordinates: 53906..55324; Gene: orf20;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpn11930 is not available.



The graph information of ICESpn11930 components from FR671403
Complete gene list of ICESpn11930 from FR671403
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1Integrase81..1589 [-], 1509Integrase
2-1674..1943 [-], 270Excisionase
3-2505..4334 [-], 1830Relaxase
4-4321..4686 [-], 366putative mobilisation protein
5-4691..5047 [-], 357putative mobilisation protein
6-5342..5632 [-], 291Conserved hypothetical protein
7-5622..5984 [-], 363Conserved hypothetical protein
8-5984..7399 [-], 1416UmuC-like DNA repair protein
9-7402..8166 [-], 765Putative helix turn helix DNA binding protein
10-8341..8721 [-], 381zeta toxin
11-8927..9670 [-], 744Neopullulanase
12rep9961..10884 [+], 924replication protein
13-11749..12399 [-], 651putative chloramphenicol acetyltransferase
14-12570..12818 [-], 249putative uncharacterized protein
15-13057..13845 [-], 789putative uncharacterized protein
16-14321..15079 [-], 759zeta toxin
17-15690..15977 [-], 288putative uncharacterized protein
18-16015..16398 [-], 384putative uncharacterized protein
19-16395..16628 [-], 234putative uncharacterized protein
20-16679..17764 [-], 1086putative uncharacterized protein
21-17774..18415 [-], 642putative uncharacterized proteinPrgL, T4SS component 
22-18575..18748 [+], 174Conserved hypothetical protein
23-18762..19058 [-], 297putative uncharacterized protein
24-19072..19356 [-], 285putative uncharacterized protein
25-19431..28164 [-], 8734putative conjugative transposon DNA recombination protein
26-20483..22294 [-], 1812putative group II intron reverse transcriptase/maturase
27-28197..28607 [-], 411putative uncharacterized protein (pseudogene)
28-29038..29730 [-], 693Membrane protein
29-29784..30353 [-], 570putative permease
30-30371..31129 [-], 759ABC transporter, ATP-binding protein
31-31624..31737 [+], 114Transposase fragment
32-31988..33205 [-], 1218putative integraseIntegrase 
33xis33287..33490 [-], 204excisionase
34orf734178..34600 [-], 423putative conjugative transposon regulatory protein
35orf935105..40729 [+], 5625putative conjugative transposon regulatory protein (pseudogene)
36-35400..38318 [-], 2919Transposase
37tnpR38322..38876 [-], 555Resolvase
38ermB39231..39968 [-], 738-
39tetM41075..43009 [-], 1935Tetracycline resistance protein
40orf1343371..44306 [-], 936putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
41orf1444303..45304 [-], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
42orf1545301..47412 [-], 2112conjugative transposon membrane proteinOrf15_Tn, T4SS component 
43orf1647481..49928 [-], 2448conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
44orf1749912..50418 [-], 507putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
45orf1850393..50890 [-], 498conjugative transposon protein
46orf1951007..51174 [-], 168conjugative transposon proteinOrf19_Tn, T4SS component 
47-51408..52655 [+], 1248Transposase
48ermB52912..53649 [-], 738erm(b) methylase; subname: full=mls methylase; subname: full=rrna adenine n-6-methyltransferase; ec=2.1.1.48; subname: full=erm(b) methylase; subname: full=mls methylase; subname: full=rRNA adenine N-6-methyltransferase; ec=2.1.1.48
49orf2053906..55324 [-], 1419putative conjugative transposon replication initiation factorRelaxase, MOBT Family
50orf2155502..56887 [-], 1386conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
51orf2256916..57302 [-], 387conjugative transposon protein
52orf2357318..57632 [-], 315conjugative transposon protein
53-58199..61012 [-], 2814putative conjugal transfer proteinPrgK, T4SS component 
54-61024..63339 [-], 2316putative conjugal transfer proteinPrgJ, T4SS component 
55-63332..63691 [-], 360putative uncharacterized protein
56-63745..64599 [-], 855putative uncharacterized proteinPrgH, T4SS component 
57-64616..64858 [-], 243putative uncharacterized protein
58traG64879..66756 [-], 1878putative conjugal transfer protein TraG
59-66756..67244 [-], 489putative uncharacterized protein
60-67234..67533 [-], 300putative uncharacterized protein
61-67816..68652 [-], 837conserved hypothetical protein
62-68652..69296 [-], 645conserved hypothetical protein
63-69370..69957 [-], 588putative membrane protein
64-69960..70193 [-], 234putative uncharacterized protein
65-70206..70586 [-], 381putative uncharacterized protein
66-70579..71028 [-], 450putative uncharacterized protein
67-71012..72370 [-], 1359putative DNA methylase
68-72469..73248 [-], 780putative replication initiator protein
69-73245..73418 [-], 174putative uncharacterized protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins66Fasta
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU