ICEberg
I. Information of ICE
ICEberg ID835
Name ICESsuJH1308-2 This is a predicted ICE derived from literature
OrganismStreptococcus suis JH1308
Size (bp)75,677
GC content [Genome] (%)37.45
Insertion siterplL
FunctionAntibiotic resistance genes: sat4, tet(M)
Species that ICE can be transferred to-
Nucleotide SequenceKX077884 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates352..76028 
Putative oriT region coordinates: 44867..44999;   oriTDB id:  200001
TAATACTGGCTTGTCAACGTCCAGACGCAAAATATTTAGGCGACGGAATCCGTGATCAGTTTAATTTCAG
AGTGGCTTTAGGTCGTATGTCTGAAATGGGCTATGGCATGATGTTTGGCAGTGACGTACAAAA
Putative relaxase coordinates: 45361..46566;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESsuJH1308-2 is not available.



The graph information of ICESsuJH1308-2 components from KX077884
Complete gene list of ICESsuJH1308-2 from KX077884
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1rplL1..366 [+], 366LSU ribosomal protein L7/L12 (P1/P2)
2-386..505 [+], 120hypothetical protein
3-565..738 [+], 174hypothetical protein
4-735..1277 [+], 543hypothetical protein
5-1243..1554 [+], 312hypothetical protein
6-1703..3058 [+], 1356modification methylase
7-3042..3470 [+], 429hypothetical protein
8-3481..3864 [+], 384hypothetical protein
9-3873..4106 [+], 234hypothetical protein
10-4109..4693 [+], 585hypothetical protein
11-4771..5259 [+], 489hypothetical protein
12-5259..7076 [+], 1818hypothetical protein
13-7094..7336 [+], 243hypothetical protein
14-7355..8209 [+], 855hypothetical protein
15-8271..8624 [+], 354hypothetical protein
16-8581..10932 [+], 2352TrsE-like proteinPrgJ, T4SS component 
17-10934..13735 [+], 2802hypothetical proteinPrgK, T4SS component 
18-13796..14641 [-], 846abortive infection protein AbiGII
19-14638..15228 [-], 591abortive infection protein AbiGI
20-15365..20296 [+], 4932agglutinin receptorPrgB, T4SS component 
21-20297..20488 [+], 192putative calcium-binding protein
22-20472..21023 [+], 552hypothetical protein
23-21073..27897 [+], 6825SNF2 family protein
24-27968..28267 [+], 300hypothetical protein
25-28281..28577 [+], 297hypothetical protein
26-28918..29091 [+], 174hypothetical protein
27-29111..29290 [-], 180hypothetical protein
28-29709..29828 [-], 120hypothetical protein
29-29905..30756 [-], 852putative aminoglycoside 6-adenylyltansferase
30-30789..31523 [-], 735ubiquinone/menaquinone biosynthesis
31-31504..32373 [-], 870hypothetical protein
32-32388..32612 [-], 225helix-turn-helix domain protein
33-34194..34328 [-], 135hypothetical protein
34-34327..34965 [+], 639hypothetical proteinPrgL, T4SS component 
35-35004..36080 [+], 1077hypothetical protein
36-36134..36361 [+], 228hypothetical protein
37-36358..36747 [+], 390hypothetical protein
38-36797..37087 [+], 291hypothetical protein
39-37157..37633 [+], 477transcription regulator, probable
40-37633..38409 [+], 777zeta toxin
41-38406..40493 [+], 2088putative ATP-dependent endonuclease
42-40480..42297 [+], 1818UvrD/REP helicase family protein
43-42392..42691 [-], 300Abi-alpha protein
44-42911..43030 [+], 120hypothetical protein
45-43053..43367 [+], 315hypothetical protein
46-43386..43769 [+], 384hypothetical protein
47-43798..45183 [+], 1386hypothetical proteinOrf21_Tn, T4SS component 
48-45186..45338 [+], 153hypothetical protein
49-45361..46566 [+], 1206putative transcriptional regulatorRelaxase, MOBT Family
50-46609..46830 [+], 222conjugation related proteinOrf19_Tn, T4SS component 
51-46947..47444 [+], 498antirestriction protein
52-47533..47925 [+], 393hypothetical proteinOrf17_Tn, T4SS component 
53-47909..50356 [+], 2448hypothetical proteinOrf16_Tn, T4SS component 
54-50425..52536 [+], 2112putative membrane proteinOrf15_Tn, T4SS component 
55-52533..53534 [+], 1002NLP/P60 family lipoproteinOrf14_Tn, T4SS component 
56-53531..54463 [+], 933hypothetical proteinOrf13_Tn, T4SS component 
57-54840..56759 [+], 1920tetracycline resistance protein TetMAR 
58-57105..57458 [-], 354hypothetical protein
59-57963..58385 [+], 423hypothetical protein
60-58382..58612 [+], 231hypothetical protein
61-58676..58804 [-], 129hypothetical protein
62-59073..59276 [+], 204Xis-Tn protein
63-59358..60575 [+], 1218integraseIntegrase 
64-60697..61593 [-], 897Abi-alpha protein
65-61835..62323 [+], 489hypothetical protein
66-62323..62688 [+], 366hypothetical protein
67-62675..64540 [+], 1866relaxase
68-64862..64984 [+], 123hypothetical protein
69-65219..65347 [+], 129hypothetical protein
70-65463..67190 [+], 1728putative asparagine synthetase
71-67202..67453 [+], 252hypothetical protein
72-67457..69679 [+], 2223ABC transporter, NBP/MSD fusion protein
73-69692..70408 [+], 717putative transport ATP-binding protein
74-70401..71189 [+], 789hypothetical protein
75-71186..71893 [+], 708hypothetical protein
76-71924..72607 [+], 684hypothetical protein
77-72592..73689 [+], 1098sensor-receptor histidine kinase NisK
78-74019..74240 [+], 222transcriptional regulator, Cro/CI family
79-74343..74465 [-], 123hypothetical protein
80-74519..74746 [+], 228hypothetical protein
81-74769..75968 [+], 1200integrase
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins80Fasta
(1) Huang J; Ma J; Shang K; Hu X; Liang Y; Li D; Wu Z; Dai L; Chen L; Wang L (2016). Evolution and Diversity of the Antimicrobial Resistance Associated Mobilome in Streptococcus suis: A Probable Mobile Genetic Elements Reservoir for Other Streptococci. Front Cell Infect Microbiol. 0.331944444. [PubMed:27774436]
 

Genomics & Bioinformatics Group in MML, SJTU