![]() | 83 |
![]() ![]() | ICESpn23771 ![]() |
![]() | Streptococcus pneumoniae 23771 |
![]() | 25880 |
![]() | 38.02 |
![]() | - |
![]() | Tetracycline resistance |
![]() | - |
![]() | FR671415 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..25880 |
![]() ![]() | coordinates: 2166..2298; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 2309..3727; Gene: orf20; Family: MOBT |
The graph information of ICESpn23771 components from FR671415 | |||||
![]() | |||||
Complete gene list of ICESpn23771 from FR671415 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | orf23 | 1..315 [+], 315 | conjugative transposon protein | ||
2 | orf22 | 334..717 [+], 384 | conjugative transposon protein | ||
3 | orf21 | 746..2131 [+], 1386 | conjugative transposon FtsK/SpoIIIE-family protein | Orf21_Tn, T4SS component | |
4 | orf20 | 2309..3727 [+], 1419 | putative conjugative transposon replication initiation factor | Relaxase, MOBT Family | |
5 | ermB | 3984..4721 [+], 738 | rRNA methylase | ||
6 | - | 4978..6225 [-], 1248 | Transposase | ||
7 | orf19 | 6405..6626 [+], 222 | conjugative transposon protein | Orf19_Tn, T4SS component | |
8 | orf18 | 6743..7240 [+], 498 | conjugative transposon protein | ||
9 | orf17 | 7491..7721 [+], 231 | putative conjugative transposon membrane protein | Orf17_Tn, T4SS component | |
10 | orf16 | 7705..10152 [+], 2448 | conjugative transposon ATP/GTP-binding protein | Orf16_Tn, T4SS component | |
11 | orf15 | 10155..12332 [+], 2178 | conjugative transposon membrane protein | Orf15_Tn, T4SS component | |
12 | orf14 | 12329..13330 [+], 1002 | putative cell wall hydrolase | Orf14_Tn, T4SS component | |
13 | orf13 | 13345..14259 [+], 915 | putative conjugative transposon exported protein | Orf13_Tn, T4SS component | |
14 | tetM | 14636..16555 [+], 1920 | conjugative transposon tetracycline resistance protein | ||
15 | - | 16767..17164 [+], 398 | UmuC/MucB-like protein | ||
16 | - | 17161..17496 [+], 336 | ImsC-like protein | ||
17 | - | 17509..17877 [+], 369 | YolD domain protein | ||
18 | mel | 18281..19744 [-], 1464 | ABC transporter ATPase subunit | ||
19 | mef | 19864..21081 [-], 1218 | Macrolide efflux transporter | ||
20 | orf9 | 22410..22763 [-], 354 | putative conjugative transposon regulatory protein | ||
21 | SPN23F13061 | 22893..23039 [+], 147 | putative uncharacterized protein | ||
22 | orf7 | 23268..23690 [+], 423 | putative conjugative transposon regulatory protein | ||
23 | xis | 24378..24581 [+], 204 | excisionase | ||
24 | Integrase | 24663..25880 [+], 1218 | putative integrase (pseudogene) | Integrase |
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] ![]() |
![]() |