 ICEberg ID | 829 |
Name  | ICESsu05SC260  |
| ICEO ID | ICEO_0000219 |
| Organism | Streptococcus suis 05SC260 |
| Size (bp) | 88,874 |
| GC content [Genome] (%) | 36.81 |
| Insertion site | rplL |
| Function | Antibiotic resistance genes: sat4, tet(M) |
| Species that ICE can be transferred to | Streptococcus suis P1/7RF; Streptococcus suis SS-1RF |
| Nucleotide Sequence | KX077888 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 875..89748 |
| Putative oriT region | coordinates: 31566..31698; oriTDB id: 200001 GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT |
| Putative relaxase | coordinates: 30350..31555; Family: MOBT |
The graph information of ICESsu05SC260 components from KX077888 | |||||
 | |||||
| Complete gene list of ICESsu05SC260 from KX077888 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 1..750 [-], 750 | putative hydrolase (HAD superfamily) | ||
| 2 | - | 935..2134 [-], 1200 | integrase | ||
| 3 | - | 2157..2384 [-], 228 | hypothetical protein | ||
| 4 | - | 2438..2560 [+], 123 | hypothetical protein | ||
| 5 | - | 2663..2884 [-], 222 | transcriptional regulator, Cro/CI family | ||
| 6 | - | 3214..4311 [-], 1098 | sensor-receptor histidine kinase NisK | ||
| 7 | - | 4296..4979 [-], 684 | hypothetical protein | ||
| 8 | - | 5010..5717 [-], 708 | hypothetical protein | ||
| 9 | - | 5714..6502 [-], 789 | hypothetical protein | ||
| 10 | - | 6495..7211 [-], 717 | putative transport ATP-binding protein | ||
| 11 | - | 7232..9454 [-], 2223 | ABC transporter, NBP/MSD fusion protein | ||
| 12 | - | 9458..9709 [-], 252 | hypothetical protein | ||
| 13 | - | 9721..11448 [-], 1728 | putative asparagine synthetase | ||
| 14 | - | 11564..11692 [-], 129 | hypothetical protein | ||
| 15 | - | 11924..12046 [-], 123 | hypothetical protein | ||
| 16 | - | 12377..14242 [-], 1866 | relaxase | ||
| 17 | - | 14229..14594 [-], 366 | hypothetical protein | ||
| 18 | - | 14594..15082 [-], 489 | hypothetical protein | ||
| 19 | - | 15324..16220 [+], 897 | Abi-alpha protein | ||
| 20 | - | 16342..17559 [-], 1218 | integrase | Integrase | |
| 21 | - | 17641..17844 [-], 204 | Xis-Tn protein | ||
| 22 | - | 18113..18241 [+], 129 | hypothetical protein | ||
| 23 | - | 18305..18535 [-], 231 | hypothetical protein | ||
| 24 | - | 18532..18954 [-], 423 | hypothetical protein | ||
| 25 | - | 19458..19811 [+], 354 | hypothetical protein | ||
| 26 | - | 20157..22076 [-], 1920 | tetracycline resistance protein TetM | AR | |
| 27 | - | 22453..23385 [-], 933 | hypothetical protein | Orf13_Tn, T4SS component | |
| 28 | - | 23382..24383 [-], 1002 | NLP/P60 family lipoprotein | Orf14_Tn, T4SS component | |
| 29 | - | 24380..26491 [-], 2112 | putative membrane protein | Orf15_Tn, T4SS component | |
| 30 | - | 26560..29007 [-], 2448 | hypothetical protein | Orf16_Tn, T4SS component | |
| 31 | - | 28991..29383 [-], 393 | hypothetical protein | Orf17_Tn, T4SS component | |
| 32 | - | 29472..29969 [-], 498 | antirestriction protein | ||
| 33 | - | 30086..30307 [-], 222 | conjugation related protein | Orf19_Tn, T4SS component | |
| 34 | - | 30350..31555 [-], 1206 | putative transcriptional regulator | Relaxase, MOBT Family | |
| 35 | - | 31578..31730 [-], 153 | hypothetical protein | ||
| 36 | - | 31733..33118 [-], 1386 | hypothetical protein | Orf21_Tn, T4SS component | |
| 37 | - | 33147..33530 [-], 384 | hypothetical protein | ||
| 38 | - | 33549..33863 [-], 315 | hypothetical protein | ||
| 39 | - | 33886..34005 [-], 120 | hypothetical protein | ||
| 40 | - | 34225..34524 [+], 300 | Abi-alpha protein | ||
| 41 | - | 34619..36436 [-], 1818 | UvrD/REP helicase family protein | ||
| 42 | - | 36423..38510 [-], 2088 | putative ATP-dependent endonuclease | ||
| 43 | - | 38507..39283 [-], 777 | zeta toxin | ||
| 44 | - | 39283..39759 [-], 477 | transcription regulator, probable | ||
| 45 | - | 39829..40119 [-], 291 | hypothetical protein | ||
| 46 | - | 40169..40558 [-], 390 | hypothetical protein | ||
| 47 | - | 40555..40782 [-], 228 | hypothetical protein | ||
| 48 | - | 40836..41912 [-], 1077 | hypothetical protein | ||
| 49 | - | 41951..42589 [-], 639 | hypothetical protein | PrgL, T4SS component | |
| 50 | - | 42588..42722 [+], 135 | hypothetical protein | ||
| 51 | - | 43990..44589 [-], 600 | DNA-binding response regulator | ||
| 52 | - | 44567..46075 [-], 1509 | putative two-component sensor histidine kinase | ||
| 53 | - | 46079..46768 [-], 690 | hypothetical protein | ||
| 54 | - | 46778..47497 [-], 720 | hypothetical protein | ||
| 55 | - | 47475..48389 [-], 915 | putative lantibiotic ABC transporter,ATP-binding | ||
| 56 | - | 48361..50430 [-], 2070 | lipid A export ATP-binding/permease protein MsbA | ||
| 57 | - | 50442..51554 [-], 1113 | lantibiotic modifying enzyme | ||
| 58 | - | 51657..51773 [+], 117 | DNA topoisomerase III | ||
| 59 | - | 51881..52378 [+], 498 | putative DNA recombinase | ||
| 60 | - | 52379..52795 [+], 417 | recombinase | ||
| 61 | - | 52797..54359 [+], 1563 | putative DNA recombinase | ||
| 62 | - | 54502..54726 [+], 225 | helix-turn-helix domain protein | ||
| 63 | - | 54741..55610 [+], 870 | hypothetical protein | ||
| 64 | - | 55591..56325 [+], 735 | ubiquinone/menaquinone biosynthesis | ||
| 65 | - | 56358..57221 [+], 864 | putative aminoglycoside 6-adenylyltansferase | ||
| 66 | - | 57265..57792 [+], 528 | adenine phosphoribosyltransferase | ||
| 67 | - | 58020..59339 [+], 1320 | transposase | ||
| 68 | - | 59528..60925 [-], 1398 | lantibiotic mersacidin modifying enzyme | ||
| 69 | - | 61009..61182 [-], 174 | hypothetical protein | ||
| 70 | - | 61523..61819 [-], 297 | hypothetical protein | ||
| 71 | - | 61833..62132 [-], 300 | hypothetical protein | ||
| 72 | - | 62203..69027 [-], 6825 | SNF2 family protein | ||
| 73 | - | 69077..69628 [-], 552 | hypothetical protein | ||
| 74 | - | 69612..69803 [-], 192 | putative calcium-binding protein | ||
| 75 | - | 69804..74699 [-], 4896 | agglutinin receptor | PrgB, T4SS component | |
| 76 | - | 74679..74834 [+], 156 | hypothetical protein | ||
| 77 | - | 74871..75461 [+], 591 | abortive infection protein AbiGI | ||
| 78 | - | 75458..76303 [+], 846 | abortive infection protein AbiGII | ||
| 79 | - | 76366..79167 [-], 2802 | hypothetical protein | PrgK, T4SS component | |
| 80 | - | 79169..81520 [-], 2352 | TrsE-like protein | PrgJ, T4SS component | |
| 81 | - | 81477..81830 [-], 354 | hypothetical protein | ||
| 82 | - | 81892..82746 [-], 855 | hypothetical protein | ||
| 83 | - | 82765..83007 [-], 243 | hypothetical protein | ||
| 84 | - | 83025..84842 [-], 1818 | hypothetical protein | ||
| 85 | - | 84842..85330 [-], 489 | hypothetical protein | ||
| 86 | - | 85408..85992 [-], 585 | hypothetical protein | ||
| 87 | - | 85995..86228 [-], 234 | hypothetical protein | ||
| 88 | - | 86237..86620 [-], 384 | hypothetical protein | ||
| 89 | - | 86631..87059 [-], 429 | hypothetical protein | ||
| 90 | - | 87043..88398 [-], 1356 | modification methylase | ||
| 91 | - | 88547..89365 [-], 819 | hypothetical protein | ||
| 92 | - | 89362..89535 [-], 174 | hypothetical protein | ||
| 93 | - | 89595..89714 [-], 120 | hypothetical protein | ||
| 94 | - | 89734..90099 [-], 366 | LSU ribosomal protein L7/L12 (P1/P2) | ||
 Flanking regions |
| (1) Huang J; Ma J; Shang K; Hu X; Liang Y; Li D; Wu Z; Dai L; Chen L; Wang L (2016). Evolution and Diversity of the Antimicrobial Resistance Associated Mobilome in Streptococcus suis: A Probable Mobile Genetic Elements Reservoir for Other Streptococci. Front Cell Infect Microbiol. 0.331944444. [PubMed:27774436] |