ICEberg
I. Information of ICE
ICEberg ID822
Name ICESpnSPN8332 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae SPN8332
Size (bp)14353
GC content [Genome] (%)37.17
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceHG799498 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..14353 
Putative oriT region coordinates: 2166..2298;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2309..3814;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpnSPN8332 is not available.



The graph information of ICESpnSPN8332 components from HG799498
Complete gene list of ICESpnSPN8332 from HG799498
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-1..315 [+], 315conjugative transposon protein
2-331..717 [+], 387conjugative transposon protein
3-746..2131 [+], 1386conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
4-2309..3814 [+], 1506putative conjugative transposon replication initiation factorRelaxase, MOBT Family
5-3907..4701 [+], 795Aminoglycoside 3' phosphotransferaseAR 
6-4977..5549 [+], 573Conserved hypothetical protein
7-5878..6147 [+], 270conjugative transposon protein
8ermB6376..7113 [+], 738rRNA methylaseAR 
9-7093..7311 [-], 219putative conjugative transposon membrane protein
10-7468..8022 [+], 555Tn917 resolvase
11-8026..10944 [+], 2919Transposase
12-11000..11239 [-], 240Conjugative element DNA binding protein
13-11735..12166 [+], 432Conserved hypothetical protein
14-12163..12393 [+], 231Conjugative element DNA binding protein
15-12851..13054 [+], 204excisionase
16Tn916 integrase13136..14353 [+], 1218integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins16Fasta
(1) Croucher NJ; Hanage WP; Harris SR; McGee L; van der Linden M; de Lencastre H; Sa-Leao R; Song JH; Ko KS; Beall B; Klugman KP; Parkhill J; Tomasz A; Kristinsson KG; Bentley SD (2014). Variable recombination dynamics during the emergence, transmission and 'disarming' of a multidrug-resistant pneumococcal clone. BMC Biol. 12:49. [PubMed:24957517] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU