ICEberg
I. Information of ICE
ICEberg ID821
Name ICESpnDCC1902 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae DCC1902
Size (bp)70658
GC content [Genome] (%)34.75
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceHG799491 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..70658 
Putative oriT region coordinates: 46641..46773;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase coordinates: 45212..46630;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpnDCC1902 is not available.



The graph information of ICESpnDCC1902 components from HG799491
Complete gene list of ICESpnDCC1902 from HG799491
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-1..174 [+], 174conserved hypothetical protein
2-171..950 [+], 780putative replication initiator protein
3-1049..2407 [+], 1359methyl transferase
4-1080..1622 [+], 543methyl transferase
5-2391..2840 [+], 450conserved hypothetical protein
6-2833..3213 [+], 381conserved hypothetical protein
7-3534..4049 [+], 516Putative membrane protein
8-4341..4976 [+], 636hypothetical protein
9-5031..5273 [+], 243caax amino protease family
10-5347..5991 [+], 645conserved hypothetical protein
11-5991..6827 [+], 837abortive infection protein AbiGII, putative
12-7109..7408 [+], 300conserved hypothetical protein
13-7422..7886 [+], 465conserved hypothetical protein
14-7886..9763 [+], 1878putative conjugal transfer protein TraG
15-9784..10026 [+], 243conserved hypothetical protein
16-10043..10897 [+], 855membrane protein, putativePrgH, T4SS component 
17-10951..11310 [+], 360conserved hypothetical protein
18-11261..13618 [+], 2358putative conjugal transfer proteinPrgJ, T4SS component 
19-13630..16443 [+], 2814putative conjugal transfer proteinPrgK, T4SS component 
20-16745..16858 [-], 114Conserved hypothetical protein
21-17209..17619 [+], 411Hypothetical protein
22-17652..23885 [+], 6234putative conjugative transposon DNA recombination protein
23-23960..24244 [+], 285conserved hypothetical protein
24-24946..26529 [+], 1584ABC effux transporter permease/ATPase subunit
25-26519..26632 [+], 114Conserved hypothetical protein
26-26791..27912 [+], 1122ThiF-domain protein
27-27905..28411 [+], 507Putative zinc dependent protease
28Tn916 integrase28565..29650 [-], 1086integrase
29-29700..29828 [+], 129hypothetical protein
30-29864..30067 [-], 204excisionase
31-30755..31177 [-], 423putative conjugative transposon regulatory protein
32-31682..32035 [+], 354putative conjugative transposon regulatory protein
33tetM32381..34315 [-], 1935conjugative transposon tetracycline resistance proteinAR 
34-34677..35612 [-], 936putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
35-35609..36610 [-], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
36-36607..38718 [-], 2112conjugative transposon membrane proteinOrf15_Tn, T4SS component 
37-38787..41111 [-], 2325conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
38-41218..41448 [-], 231putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
39-41699..42196 [-], 498conjugative transposon protein
40-42313..42534 [-], 222conjugative transposon proteinOrf19_Tn, T4SS component 
41-42714..43961 [+], 1248transposase
42ermB44218..44955 [-], 738rRNA adenine N-6-methyltransferaseAR 
43-45212..46630 [-], 1419putative conjugative transposon replication initiation factorRelaxase, MOBT Family
44-46808..48190 [-], 1383conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
45-48219..48605 [-], 387conjugative transposon protein
46-48621..48908 [-], 288conjugative transposon protein
47-49241..49954 [+], 714hypothetical protein
48-49917..50813 [-], 897HTH-domain DNA binding protein
49-51976..52617 [+], 642Conserved hypothetical proteinPrgL, T4SS component 
50-52627..53712 [+], 1086conserved hypothetical protein
51-53763..53996 [+], 234conserved hypothetical protein
52-53993..54376 [+], 384conserved hypothetical protein
53-54489..54689 [+], 201Conserved hypothetical protein
54-54771..55403 [+], 633Conserved hypothetical protein
55-55394..55621 [+], 228Conserved hypothetical protein
56-55742..55921 [-], 180Conserved hypothetical protein
57-55991..56362 [+], 372Conserved hypothetical protein
58-56739..57635 [-], 897IntegraseIntegrase 
59-57729..58979 [+], 1251Conserved hypothetical protein
60-58976..59548 [-], 573Conserved hypothetical protein
61-60199..62268 [+], 2070putative ATPase
62uvrD62255..64072 [+], 1818UvrD-family protein
63-64158..65333 [-], 1176Abi-alpha protein, putative
64-65692..66048 [+], 357putative mobilisation protein
65-66053..66418 [+], 366putative mobilisation protein
66-66405..68234 [+], 1830Relaxase
67Integrase69150..70658 [+], 1509Integrase
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins67Fasta
(1) Croucher NJ; Hanage WP; Harris SR; McGee L; van der Linden M; de Lencastre H; Sa-Leao R; Song JH; Ko KS; Beall B; Klugman KP; Parkhill J; Tomasz A; Kristinsson KG; Bentley SD (2014). Variable recombination dynamics during the emergence, transmission and 'disarming' of a multidrug-resistant pneumococcal clone. BMC Biol. 12:49. [PubMed:24957517] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU