ICEberg
I. Information of ICE
ICEberg ID820
Name ICESpnDCC1738 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae DCC1738
Size (bp)67809
GC content [Genome] (%)34.77
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceHG799492 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..67809 
Putative oriT region coordinates: 43792..43924;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase coordinates: 42576..43781;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpnDCC1738 is not available.



The graph information of ICESpnDCC1738 components from HG799492
Complete gene list of ICESpnDCC1738 from HG799492
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-1..174 [+], 174conserved hypothetical protein
2-171..950 [+], 780putative replication initiator protein
3-1049..2407 [+], 1359methyl transferase
4-1080..1622 [+], 543methyl transferase
5-2391..2840 [+], 450conserved hypothetical protein
6-2833..3213 [+], 381conserved hypothetical protein
7-3534..4049 [+], 516Putative membrane protein
8-4341..4976 [+], 636hypothetical protein
9-5031..5273 [+], 243caax amino protease family
10-5401..5991 [+], 591conserved hypothetical protein
11-5991..6827 [+], 837abortive infection protein AbiGII, putative
12-7109..7408 [+], 300conserved hypothetical protein
13-7422..7886 [+], 465conserved hypothetical protein
14-7886..9763 [+], 1878putative conjugal transfer protein TraG
15-9784..10026 [+], 243conserved hypothetical protein
16-10043..10897 [+], 855membrane protein, putativePrgH, T4SS component 
17-10951..11310 [+], 360conserved hypothetical protein
18-11261..13618 [+], 2358putative conjugal transfer proteinPrgJ, T4SS component 
19-13630..16443 [+], 2814putative conjugal transfer proteinPrgK, T4SS component 
20-16745..16858 [-], 114Conserved hypothetical protein
21-17209..17619 [+], 411Hypothetical protein
22-17652..23885 [+], 6234putative conjugative transposon DNA recombination protein
23-23960..24244 [+], 285conserved hypothetical protein
24-24945..26528 [+], 1584ABC effux transporter permease/ATPase subunit
25-26518..26631 [+], 114Conserved hypothetical protein
26-26790..27911 [+], 1122ThiF-domain protein
27-27964..28410 [+], 447Putative zinc dependent protease
28Tn916 integrase28564..29649 [-], 1086integrase
29-29863..30066 [-], 204excisionase
30-30754..31176 [-], 423putative conjugative transposon regulatory protein
31-31681..32034 [+], 354putative conjugative transposon regulatory protein
32tetM32380..34314 [-], 1935conjugative transposon tetracycline resistance proteinAR 
33-34676..35611 [-], 936putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
34-35608..36609 [-], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
35-36606..38717 [-], 2112conjugative transposon membrane proteinOrf15_Tn, T4SS component 
36-38786..41110 [-], 2325conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
37-41217..41447 [-], 231putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
38-41698..42195 [-], 498conjugative transposon protein
39-42312..42479 [-], 168conjugative transposon proteinOrf19_Tn, T4SS component 
40-42576..43781 [-], 1206putative conjugative transposon replication initiation factorRelaxase, MOBT Family
41-43959..45341 [-], 1383conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
42-45370..45756 [-], 387conjugative transposon protein
43-45772..46059 [-], 288conjugative transposon protein
44-46392..47105 [+], 714hypothetical protein
45-47068..47964 [-], 897HTH-domain DNA binding protein
46-49127..49768 [+], 642Conserved hypothetical proteinPrgL, T4SS component 
47-49778..50863 [+], 1086conserved hypothetical protein
48-50914..51147 [+], 234conserved hypothetical protein
49-51144..51527 [+], 384conserved hypothetical protein
50-51640..51840 [+], 201conserved hypothetical protein
51-51922..52554 [+], 633Conserved hypothetical protein
52-52545..52772 [+], 228Conserved hypothetical protein
53-52893..53072 [-], 180Conserved hypothetical protein
54-53142..53513 [+], 372Conserved hypothetical protein
55-53890..54786 [-], 897IntegraseIntegrase 
56-54880..55452 [+], 573Conserved hypothetical protein
57-55449..56699 [-], 1251Conserved hypothetical protein
58-57350..59419 [+], 2070putative ATPase
59uvrD59406..61223 [+], 1818UvrD-family protein
60-61309..62484 [-], 1176Abi-alpha protein, putative
61-62843..63199 [+], 357putative mobilisation protein
62-63204..63569 [+], 366putative mobilisation protein
63-63556..65385 [+], 1830Relaxase
64Integrase66301..67809 [+], 1509Integrase
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins64Fasta
(1) Croucher NJ; Hanage WP; Harris SR; McGee L; van der Linden M; de Lencastre H; Sa-Leao R; Song JH; Ko KS; Beall B; Klugman KP; Parkhill J; Tomasz A; Kristinsson KG; Bentley SD (2014). Variable recombination dynamics during the emergence, transmission and 'disarming' of a multidrug-resistant pneumococcal clone. BMC Biol. 12:49. [PubMed:24957517] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU