ICEberg
I. Information of ICE
ICEberg ID82
Name ICESpnH034800032 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae H034800032
Size (bp)20370
GC content [Genome] (%)38.47
Insertion site-
FunctionTetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceFR671414 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..20370 
Putative oriT region coordinates: 2166..2298;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2309..3727; Gene: orf20;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpnH034800032 is not available.



The graph information of ICESpnH034800032 components from FR671414
Complete gene list of ICESpnH034800032 from FR671414
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1orf231..315 [+], 315conjugative transposon protein
2orf22334..717 [+], 384conjugative transposon protein
3orf21746..2131 [+], 1386conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
4orf202309..3727 [+], 1419putative conjugative transposon replication initiation factorRelaxase, MOBT Family
5ermB3984..4721 [+], 738rRNA methylase
6-4978..6225 [-], 1248Transposase
7orf196405..6626 [+], 222conjugative transposon proteinOrf19_Tn, T4SS component 
8orf186743..7240 [+], 498conjugative transposon protein
9orf177491..7721 [+], 231putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
10orf167705..10152 [+], 2448conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
11orf1510155..12332 [+], 2178conjugative transposon membrane proteinOrf15_Tn, T4SS component 
12orf1412329..13330 [+], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
13orf1313345..14259 [+], 915putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
14tetM14636..16555 [+], 1920conjugative transposon tetracycline resistance protein
15orf916901..17254 [-], 354putative conjugative transposon regulatory protein
16SPN23F1306117384..17530 [+], 147putative uncharacterized protein
17orf717759..18181 [+], 423putative conjugative transposon regulatory protein
18xis18869..19072 [+], 204excisionase
19int19154..20370 [+], 1217putative integrase (pseudogene)Integrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins19Fasta
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU