 ICEberg ID | 819 |
Name  | ICESpnDCC1524  |
| Organism | Streptococcus pneumoniae DCC1524 |
| Size (bp) | 58942 |
| GC content [Genome] (%) | 35.06 |
| Insertion site | - |
| Function | - |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | HG799493 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..58942 |
| Putative oriT region | coordinates: 19175..19307; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
| Putative relaxase | coordinates: 19318..20580; Family: MOBT |
The graph information of ICESpnDCC1524 components from HG799493 | |||||
 | |||||
| Complete gene list of ICESpnDCC1524 from HG799493 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 1..174 [+], 174 | conserved hypothetical protein | ||
| 2 | - | 171..950 [+], 780 | putative replication initiator protein | ||
| 3 | - | 1049..2407 [+], 1359 | methyl transferase | ||
| 4 | - | 1080..1622 [+], 543 | methyl transferase | ||
| 5 | - | 2391..2840 [+], 450 | conserved hypothetical protein | ||
| 6 | - | 2833..3213 [+], 381 | conserved hypothetical protein | ||
| 7 | - | 3462..4049 [+], 588 | Putative membrane protein | ||
| 8 | - | 4341..4976 [+], 636 | hypothetical protein | ||
| 9 | - | 5031..5273 [+], 243 | caax amino protease family | ||
| 10 | - | 5401..5991 [+], 591 | conserved hypothetical protein | ||
| 11 | - | 5991..6827 [+], 837 | putative abortive infection protein AbiGII | ||
| 12 | - | 7109..7408 [+], 300 | conserved hypothetical protein | ||
| 13 | - | 7422..7886 [+], 465 | conserved hypothetical protein | ||
| 14 | - | 7883..9763 [+], 1881 | putative conjugal transfer protein TraG | ||
| 15 | - | 9784..10026 [+], 243 | conserved hypothetical protein | ||
| 16 | - | 10043..10897 [+], 855 | membrane protein, putative | PrgH, T4SS component | |
| 17 | - | 10951..11310 [+], 360 | conserved hypothetical protein | ||
| 18 | - | 11303..13618 [+], 2316 | putative conjugal transfer protein | PrgJ, T4SS component | |
| 19 | - | 13630..16443 [+], 2814 | putative conjugal transfer protein | PrgK, T4SS component | |
| 20 | - | 17037..17324 [+], 288 | conjugative transposon protein | ||
| 21 | - | 17340..17726 [+], 387 | conjugative transposon protein | ||
| 22 | - | 17755..19140 [+], 1386 | conjugative transposon FtsK/SpoIIIE-family protein | Orf21_Tn, T4SS component | |
| 23 | - | 19318..20580 [+], 1263 | putative conjugative transposon replication initiation factor | Relaxase, MOBT Family | |
| 24 | ermB | 20994..21731 [+], 738 | rRNA adenine N-6-methyltransferase | AR | |
| 25 | - | 21988..23235 [-], 1248 | transposase | ||
| 26 | - | 23415..23636 [+], 222 | conjugative transposon protein | Orf19_Tn, T4SS component | |
| 27 | - | 23753..24250 [+], 498 | conjugative transposon protein | ||
| 28 | - | 24501..24731 [+], 231 | putative conjugative transposon membrane protein | Orf17_Tn, T4SS component | |
| 29 | - | 24838..27162 [+], 2325 | conjugative transposon ATP/GTP-binding protein | Orf16_Tn, T4SS component | |
| 30 | - | 27231..29342 [+], 2112 | conjugative transposon membrane protein | Orf15_Tn, T4SS component | |
| 31 | - | 29339..30340 [+], 1002 | putative cell wall hydrolase | Orf14_Tn, T4SS component | |
| 32 | - | 30337..31269 [+], 933 | putative conjugative transposon exported protein | Orf13_Tn, T4SS component | |
| 33 | tetM | 31631..33565 [+], 1935 | conjugative transposon tetracycline resistance protein | AR | |
| 34 | - | 33911..34264 [-], 354 | putative conjugative transposon regulatory protein | ||
| 35 | - | 34769..35191 [+], 423 | putative conjugative transposon regulatory protein | ||
| 36 | - | 35879..36082 [+], 204 | excisionase | ||
| 37 | Tn916 integrase | 36296..37381 [+], 1086 | integrase | ||
| 38 | - | 37558..38238 [+], 681 | hypothetical protein | ||
| 39 | - | 38201..39097 [-], 897 | HTH-domain DNA binding protein | ||
| 40 | - | 39376..39564 [-], 189 | Hypothetical protein | ||
| 41 | - | 40260..40901 [+], 642 | Conserved hypothetical protein | PrgL, T4SS component | |
| 42 | - | 40911..41996 [+], 1086 | conserved hypothetical protein | ||
| 43 | - | 42047..42280 [+], 234 | conserved hypothetical protein | ||
| 44 | - | 42277..42660 [+], 384 | conserved hypothetical protein | ||
| 45 | - | 42773..42973 [+], 201 | conserved hypothetical protein | ||
| 46 | - | 43055..43687 [+], 633 | Conserved hypothetical protein | ||
| 47 | - | 43678..43905 [+], 228 | Conserved hypothetical protein | ||
| 48 | - | 44026..44205 [-], 180 | Conserved hypothetical protein | ||
| 49 | - | 44275..44646 [+], 372 | Conserved hypothetical protein | ||
| 50 | - | 45023..45919 [-], 897 | Integrase | Integrase | |
| 51 | - | 46013..46585 [+], 573 | Conserved hypothetical protein | ||
| 52 | - | 46582..47832 [-], 1251 | Conserved hypothetical protein | ||
| 53 | - | 48483..50552 [+], 2070 | putative ATPase | ||
| 54 | uvrD | 50539..52356 [+], 1818 | UvrD-family protein | ||
| 55 | - | 52442..53617 [-], 1176 | Abi-alpha protein, putative | ||
| 56 | - | 53976..54332 [+], 357 | putative mobilisation protein | ||
| 57 | - | 54337..54702 [+], 366 | putative mobilisation protein | ||
| 58 | - | 54689..56518 [+], 1830 | Relaxase | ||
| 59 | Integrase | 57434..58942 [+], 1509 | Integrase | ||
(1) Croucher NJ; Hanage WP; Harris SR; McGee L; van der Linden M; de Lencastre H; Sa-Leao R; Song JH; Ko KS; Beall B; Klugman KP; Parkhill J; Tomasz A; Kristinsson KG; Bentley SD (2014). Variable recombination dynamics during the emergence, transmission and 'disarming' of a multidrug-resistant pneumococcal clone. BMC Biol. 12:49. [PubMed:24957517] 
|
| experimental literature |