ICEberg
I. Information of ICE
ICEberg ID819
Name ICESpnDCC1524 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae DCC1524
Size (bp)58942
GC content [Genome] (%)35.06
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceHG799493 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..58942 
Putative oriT region coordinates: 19175..19307;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 19318..20580;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpnDCC1524 is not available.



The graph information of ICESpnDCC1524 components from HG799493
Complete gene list of ICESpnDCC1524 from HG799493
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-1..174 [+], 174conserved hypothetical protein
2-171..950 [+], 780putative replication initiator protein
3-1049..2407 [+], 1359methyl transferase
4-1080..1622 [+], 543methyl transferase
5-2391..2840 [+], 450conserved hypothetical protein
6-2833..3213 [+], 381conserved hypothetical protein
7-3462..4049 [+], 588Putative membrane protein
8-4341..4976 [+], 636hypothetical protein
9-5031..5273 [+], 243caax amino protease family
10-5401..5991 [+], 591conserved hypothetical protein
11-5991..6827 [+], 837putative abortive infection protein AbiGII
12-7109..7408 [+], 300conserved hypothetical protein
13-7422..7886 [+], 465conserved hypothetical protein
14-7883..9763 [+], 1881putative conjugal transfer protein TraG
15-9784..10026 [+], 243conserved hypothetical protein
16-10043..10897 [+], 855membrane protein, putativePrgH, T4SS component 
17-10951..11310 [+], 360conserved hypothetical protein
18-11303..13618 [+], 2316putative conjugal transfer proteinPrgJ, T4SS component 
19-13630..16443 [+], 2814putative conjugal transfer proteinPrgK, T4SS component 
20-17037..17324 [+], 288conjugative transposon protein
21-17340..17726 [+], 387conjugative transposon protein
22-17755..19140 [+], 1386conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
23-19318..20580 [+], 1263putative conjugative transposon replication initiation factorRelaxase, MOBT Family
24ermB20994..21731 [+], 738rRNA adenine N-6-methyltransferaseAR 
25-21988..23235 [-], 1248transposase
26-23415..23636 [+], 222conjugative transposon proteinOrf19_Tn, T4SS component 
27-23753..24250 [+], 498conjugative transposon protein
28-24501..24731 [+], 231putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
29-24838..27162 [+], 2325conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
30-27231..29342 [+], 2112conjugative transposon membrane proteinOrf15_Tn, T4SS component 
31-29339..30340 [+], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
32-30337..31269 [+], 933putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
33tetM31631..33565 [+], 1935conjugative transposon tetracycline resistance proteinAR 
34-33911..34264 [-], 354putative conjugative transposon regulatory protein
35-34769..35191 [+], 423putative conjugative transposon regulatory protein
36-35879..36082 [+], 204excisionase
37Tn916 integrase36296..37381 [+], 1086integrase
38-37558..38238 [+], 681hypothetical protein
39-38201..39097 [-], 897HTH-domain DNA binding protein
40-39376..39564 [-], 189Hypothetical protein
41-40260..40901 [+], 642Conserved hypothetical proteinPrgL, T4SS component 
42-40911..41996 [+], 1086conserved hypothetical protein
43-42047..42280 [+], 234conserved hypothetical protein
44-42277..42660 [+], 384conserved hypothetical protein
45-42773..42973 [+], 201conserved hypothetical protein
46-43055..43687 [+], 633Conserved hypothetical protein
47-43678..43905 [+], 228Conserved hypothetical protein
48-44026..44205 [-], 180Conserved hypothetical protein
49-44275..44646 [+], 372Conserved hypothetical protein
50-45023..45919 [-], 897IntegraseIntegrase 
51-46013..46585 [+], 573Conserved hypothetical protein
52-46582..47832 [-], 1251Conserved hypothetical protein
53-48483..50552 [+], 2070putative ATPase
54uvrD50539..52356 [+], 1818UvrD-family protein
55-52442..53617 [-], 1176Abi-alpha protein, putative
56-53976..54332 [+], 357putative mobilisation protein
57-54337..54702 [+], 366putative mobilisation protein
58-54689..56518 [+], 1830Relaxase
59Integrase57434..58942 [+], 1509Integrase
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins59Fasta
(1) Croucher NJ; Hanage WP; Harris SR; McGee L; van der Linden M; de Lencastre H; Sa-Leao R; Song JH; Ko KS; Beall B; Klugman KP; Parkhill J; Tomasz A; Kristinsson KG; Bentley SD (2014). Variable recombination dynamics during the emergence, transmission and 'disarming' of a multidrug-resistant pneumococcal clone. BMC Biol. 12:49. [PubMed:24957517] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU