ICEberg
I. Information of ICE
ICEberg ID817
Name ICESpn6BST273 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae PMEN22
Size (bp)76642
GC content [Genome] (%)34.79
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceHG799495 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..76642 
Putative oriT region coordinates: 44930..45062;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 45073..46278;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpn6BST273 is not available.



The graph information of ICESpn6BST273 components from HG799495
Complete gene list of ICESpn6BST273 from HG799495
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-1..213 [+], 213putative uncharacterized protein
2-210..989 [+], 780putative replication initiator protein
3-1089..2447 [+], 1359putative DNA methylase
4-2431..2880 [+], 450putative uncharacterized protein
5-2873..3253 [+], 381putative uncharacterized protein
6-3266..3499 [+], 234putative uncharacterized protein
7-3502..4089 [+], 588putative CAAX amino terminal protease
8-4220..4810 [+], 591conserved hypothetical protein
9-4810..5646 [+], 837conserved hypothetical protein
10-5929..6228 [+], 300putative uncharacterized protein
11-6242..6706 [+], 465putative uncharacterized protein
12-6706..8583 [+], 1878putative conjugal transfer protein TraG
13-8604..8846 [+], 243putative uncharacterized protein
14-8863..9717 [+], 855putative uncharacterized proteinPrgH, T4SS component 
15-9771..10130 [+], 360putative uncharacterized protein
16-10123..12438 [+], 2316putative conjugal transfer proteinPrgJ, T4SS component 
17-12450..15263 [+], 2814putative conjugal transfer proteinPrgK, T4SS component 
18-15298..15906 [-], 609Conserved hypothetical protein
19-15908..16072 [-], 165Conserved hypothetical protein
20-16128..16421 [-], 294Conserved hypothetical protein
21-16976..23209 [+], 6234putative conjugative transposon DNA recombination protein
22-23284..23568 [+], 285putative uncharacterized protein
23-24225..24866 [+], 642putative uncharacterized proteinPrgL, T4SS component 
24-24876..25961 [+], 1086putative uncharacterized protein
25-26012..26245 [+], 234putative uncharacterized protein
26-26242..26625 [+], 384putative uncharacterized protein
27-26738..26935 [+], 198putative uncharacterized protein
28-27093..27479 [+], 387putative epsilon antitoxin
29-27479..28231 [+], 753zeta toxin
30-28421..28558 [+], 138Conserved hypothetical protein
31-28616..28828 [+], 213Conserved hypothetical protein
32-28849..29055 [+], 207Conserved hypothetical protein
33-29252..30148 [-], 897putative integraseIntegrase 
34-30242..30814 [+], 573Conserved hypothetical protein
35-30811..32061 [-], 1251Conserved hypothetical protein
36-32712..34781 [+], 2070putative ATPase
37uvrD34768..36585 [+], 1818UvrD domain protein
38-36671..37846 [-], 1176putative ATPase
39-38208..38564 [+], 357Tn5252 orf10 protein
40-38569..38934 [+], 366Tn5252 orf9 protein
41-38921..40744 [+], 1824Tn5252 relaxase
42-40948..41196 [+], 249Conserved hypothetical protein
43-41301..42164 [-], 864putative transcriptional regulator
44-42355..42525 [+], 171putative secreted protein
45-42954..43241 [+], 288conjugative transposon protein
46-43257..43643 [+], 387conjugative transposon protein
47-43672..44895 [+], 1224conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
48-45073..46278 [+], 1206putative conjugative transposon replication initiation factorRelaxase, MOBT Family
49-46321..46542 [+], 222conjugative transposon proteinOrf19_Tn, T4SS component 
50-46659..47156 [+], 498conjugative transposon protein
51-47407..47637 [+], 231putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
52-47744..50068 [+], 2325conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
53-50137..52248 [+], 2112conjugative transposon membrane proteinOrf15_Tn, T4SS component 
54-52245..53246 [+], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
55-53243..54175 [+], 933putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
56tetM54537..56471 [+], 1935conjugative transposon tetracycline resistance proteinAR 
57ermB57578..58315 [+], 738rRNA methylaseAR 
58-58670..59224 [+], 555Tn917 resolvase
59-59228..62146 [+], 2919Tn917 tranposase
60-62946..63368 [+], 423putative conjugative transposon regulatory protein
61-64056..64259 [+], 204excisionase
62Tn916 integrase64473..65558 [+], 1086putative integrase
63-67171..67728 [+], 558Conserved hypothetical protein
64-67838..69613 [+], 1776ABC efflux transporter
65-69634..71034 [+], 1401ABC transporter ATPase subunit
66-71662..71811 [+], 150Conserved hypothetical protein
67-71985..73166 [+], 1182MFS transporter
68-73863..74120 [+], 258Conseved hypothetical protein
69-75175..75483 [+], 309conserved hypothetical protein
70Integrase75455..76642 [+], 1188integrase
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins70Fasta
(1) Croucher NJ; Hanage WP; Harris SR; McGee L; van der Linden M; de Lencastre H; Sa-Leao R; Song JH; Ko KS; Beall B; Klugman KP; Parkhill J; Tomasz A; Kristinsson KG; Bentley SD (2014). Variable recombination dynamics during the emergence, transmission and 'disarming' of a multidrug-resistant pneumococcal clone. BMC Biol. 12:49. [PubMed:24957517] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU