![]() | 817 |
![]() ![]() | ICESpn6BST273 ![]() |
![]() | Streptococcus pneumoniae PMEN22 |
![]() | 76642 |
![]() | 34.79 |
![]() | - |
![]() | - |
![]() | - |
![]() | HG799495 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..76642 |
![]() ![]() | coordinates: 44930..45062; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 45073..46278; Family: MOBT |
The graph information of ICESpn6BST273 components from HG799495 | |||||
![]() | |||||
Complete gene list of ICESpn6BST273 from HG799495 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 1..213 [+], 213 | putative uncharacterized protein | ||
2 | - | 210..989 [+], 780 | putative replication initiator protein | ||
3 | - | 1089..2447 [+], 1359 | putative DNA methylase | ||
4 | - | 2431..2880 [+], 450 | putative uncharacterized protein | ||
5 | - | 2873..3253 [+], 381 | putative uncharacterized protein | ||
6 | - | 3266..3499 [+], 234 | putative uncharacterized protein | ||
7 | - | 3502..4089 [+], 588 | putative CAAX amino terminal protease | ||
8 | - | 4220..4810 [+], 591 | conserved hypothetical protein | ||
9 | - | 4810..5646 [+], 837 | conserved hypothetical protein | ||
10 | - | 5929..6228 [+], 300 | putative uncharacterized protein | ||
11 | - | 6242..6706 [+], 465 | putative uncharacterized protein | ||
12 | - | 6706..8583 [+], 1878 | putative conjugal transfer protein TraG | ||
13 | - | 8604..8846 [+], 243 | putative uncharacterized protein | ||
14 | - | 8863..9717 [+], 855 | putative uncharacterized protein | PrgH, T4SS component | |
15 | - | 9771..10130 [+], 360 | putative uncharacterized protein | ||
16 | - | 10123..12438 [+], 2316 | putative conjugal transfer protein | PrgJ, T4SS component | |
17 | - | 12450..15263 [+], 2814 | putative conjugal transfer protein | PrgK, T4SS component | |
18 | - | 15298..15906 [-], 609 | Conserved hypothetical protein | ||
19 | - | 15908..16072 [-], 165 | Conserved hypothetical protein | ||
20 | - | 16128..16421 [-], 294 | Conserved hypothetical protein | ||
21 | - | 16976..23209 [+], 6234 | putative conjugative transposon DNA recombination protein | ||
22 | - | 23284..23568 [+], 285 | putative uncharacterized protein | ||
23 | - | 24225..24866 [+], 642 | putative uncharacterized protein | PrgL, T4SS component | |
24 | - | 24876..25961 [+], 1086 | putative uncharacterized protein | ||
25 | - | 26012..26245 [+], 234 | putative uncharacterized protein | ||
26 | - | 26242..26625 [+], 384 | putative uncharacterized protein | ||
27 | - | 26738..26935 [+], 198 | putative uncharacterized protein | ||
28 | - | 27093..27479 [+], 387 | putative epsilon antitoxin | ||
29 | - | 27479..28231 [+], 753 | zeta toxin | ||
30 | - | 28421..28558 [+], 138 | Conserved hypothetical protein | ||
31 | - | 28616..28828 [+], 213 | Conserved hypothetical protein | ||
32 | - | 28849..29055 [+], 207 | Conserved hypothetical protein | ||
33 | - | 29252..30148 [-], 897 | putative integrase | Integrase | |
34 | - | 30242..30814 [+], 573 | Conserved hypothetical protein | ||
35 | - | 30811..32061 [-], 1251 | Conserved hypothetical protein | ||
36 | - | 32712..34781 [+], 2070 | putative ATPase | ||
37 | uvrD | 34768..36585 [+], 1818 | UvrD domain protein | ||
38 | - | 36671..37846 [-], 1176 | putative ATPase | ||
39 | - | 38208..38564 [+], 357 | Tn5252 orf10 protein | ||
40 | - | 38569..38934 [+], 366 | Tn5252 orf9 protein | ||
41 | - | 38921..40744 [+], 1824 | Tn5252 relaxase | ||
42 | - | 40948..41196 [+], 249 | Conserved hypothetical protein | ||
43 | - | 41301..42164 [-], 864 | putative transcriptional regulator | ||
44 | - | 42355..42525 [+], 171 | putative secreted protein | ||
45 | - | 42954..43241 [+], 288 | conjugative transposon protein | ||
46 | - | 43257..43643 [+], 387 | conjugative transposon protein | ||
47 | - | 43672..44895 [+], 1224 | conjugative transposon FtsK/SpoIIIE-family protein | Orf21_Tn, T4SS component | |
48 | - | 45073..46278 [+], 1206 | putative conjugative transposon replication initiation factor | Relaxase, MOBT Family | |
49 | - | 46321..46542 [+], 222 | conjugative transposon protein | Orf19_Tn, T4SS component | |
50 | - | 46659..47156 [+], 498 | conjugative transposon protein | ||
51 | - | 47407..47637 [+], 231 | putative conjugative transposon membrane protein | Orf17_Tn, T4SS component | |
52 | - | 47744..50068 [+], 2325 | conjugative transposon ATP/GTP-binding protein | Orf16_Tn, T4SS component | |
53 | - | 50137..52248 [+], 2112 | conjugative transposon membrane protein | Orf15_Tn, T4SS component | |
54 | - | 52245..53246 [+], 1002 | putative cell wall hydrolase | Orf14_Tn, T4SS component | |
55 | - | 53243..54175 [+], 933 | putative conjugative transposon exported protein | Orf13_Tn, T4SS component | |
56 | tetM | 54537..56471 [+], 1935 | conjugative transposon tetracycline resistance protein | AR | |
57 | ermB | 57578..58315 [+], 738 | rRNA methylase | AR | |
58 | - | 58670..59224 [+], 555 | Tn917 resolvase | ||
59 | - | 59228..62146 [+], 2919 | Tn917 tranposase | ||
60 | - | 62946..63368 [+], 423 | putative conjugative transposon regulatory protein | ||
61 | - | 64056..64259 [+], 204 | excisionase | ||
62 | Tn916 integrase | 64473..65558 [+], 1086 | putative integrase | ||
63 | - | 67171..67728 [+], 558 | Conserved hypothetical protein | ||
64 | - | 67838..69613 [+], 1776 | ABC efflux transporter | ||
65 | - | 69634..71034 [+], 1401 | ABC transporter ATPase subunit | ||
66 | - | 71662..71811 [+], 150 | Conserved hypothetical protein | ||
67 | - | 71985..73166 [+], 1182 | MFS transporter | ||
68 | - | 73863..74120 [+], 258 | Conseved hypothetical protein | ||
69 | - | 75175..75483 [+], 309 | conserved hypothetical protein | ||
70 | Integrase | 75455..76642 [+], 1188 | integrase |
(1) Croucher NJ; Hanage WP; Harris SR; McGee L; van der Linden M; de Lencastre H; Sa-Leao R; Song JH; Ko KS; Beall B; Klugman KP; Parkhill J; Tomasz A; Kristinsson KG; Bentley SD (2014). Variable recombination dynamics during the emergence, transmission and 'disarming' of a multidrug-resistant pneumococcal clone. BMC Biol. 12:49. [PubMed:24957517] ![]() |
![]() |