ICEberg
I. Information of ICE
ICEberg ID815
Name ICESpn22664 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae 22664
Size (bp)61429
GC content [Genome] (%)34.96
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceHG799489 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..61429 
Putative oriT region coordinates: 37412..37544;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase coordinates: 36196..37401;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpn22664 is not available.



The graph information of ICESpn22664 components from HG799489
Complete gene list of ICESpn22664 from HG799489
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-1..174 [+], 174conserved hypothetical protein
2-171..950 [+], 780putative replication initiator protein
3-1049..2407 [+], 1359methyl transferase
4-1080..1622 [+], 543methyl transferase
5-2391..2840 [+], 450conserved hypothetical protein
6-2833..3213 [+], 381conserved hypothetical protein
7-3534..4049 [+], 516Putative membrane protein
8-4341..4976 [+], 636hypothetical protein
9-5031..5273 [+], 243caax amino protease family
10-5401..5991 [+], 591conserved hypothetical protein
11-5991..6827 [+], 837abortive infection protein AbiGII, putative
12-7110..7409 [+], 300conserved hypothetical protein
13-7423..7887 [+], 465conserved hypothetical protein
14-7884..9764 [+], 1881putative conjugal transfer protein TraG
15-9785..10027 [+], 243conserved hypothetical protein
16-10044..10898 [+], 855membrane protein, putativePrgH, T4SS component 
17-10952..11311 [+], 360conserved hypothetical protein
18-11262..13619 [+], 2358putative conjugal transfer proteinPrgJ, T4SS component 
19-13631..16444 [+], 2814putative conjugal transfer proteinPrgK, T4SS component 
20-18049..18177 [+], 129hypothetical protein
21-18213..18416 [-], 204excisionase
22-19104..19526 [-], 423putative conjugative transposon regulatory protein
23-20326..23244 [-], 2919Tn917 transposase
24-23248..23802 [-], 555Tn917 resolvase
25ermB24157..24894 [-], 738rRNA adenine N-6-methyltransferaseAR 
26-28296..29231 [-], 936putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
27-29228..30229 [-], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
28-30226..32337 [-], 2112conjugative transposon membrane proteinOrf15_Tn, T4SS component 
29-32406..34730 [-], 2325conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
30-34837..35274 [-], 438putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
31-35318..35815 [-], 498conjugative transposon protein
32-35932..36153 [-], 222conjugative transposon proteinOrf19_Tn, T4SS component 
33-36196..37401 [-], 1206putative conjugative transposon replication initiation factorRelaxase, MOBT Family
34-37579..38961 [-], 1383conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
35-38990..39376 [-], 387conjugative transposon protein
36-39392..39679 [-], 288conjugative transposon protein
37-40012..40725 [+], 714hypothetical protein
38-40688..41584 [-], 897HTH-domain DNA binding protein
39-42747..43388 [+], 642Conserved hypothetical proteinPrgL, T4SS component 
40-43398..44483 [+], 1086conserved hypothetical protein
41-44534..44767 [+], 234conserved hypothetical protein
42-44764..45147 [+], 384conserved hypothetical protein
43-45260..45460 [+], 201conserved hypothetical protein
44-45542..46174 [+], 633Conserved hypothetical protein
45-46165..46392 [+], 228Conserved hypothetical protein
46-46513..46692 [-], 180Conserved hypothetical protein
47-46762..47133 [+], 372Conserved hypothetical protein
48-47510..48406 [-], 897IntegraseIntegrase 
49-48500..49750 [+], 1251Conserved hypothetical protein
50-49747..50319 [-], 573Conserved hypothetical protein
51-50970..53039 [+], 2070putative ATPase
52uvrD53026..54843 [+], 1818UvrD-family protein
53-54929..56104 [-], 1176Abi-alpha protein, putative
54-56463..56819 [+], 357putative mobilisation protein
55-56824..57189 [+], 366putative mobilisation protein
56-57176..59005 [+], 1830Relaxase
57Integrase59921..61429 [+], 1509Integrase
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins57Fasta
(1) Croucher NJ; Hanage WP; Harris SR; McGee L; van der Linden M; de Lencastre H; Sa-Leao R; Song JH; Ko KS; Beall B; Klugman KP; Parkhill J; Tomasz A; Kristinsson KG; Bentley SD (2014). Variable recombination dynamics during the emergence, transmission and 'disarming' of a multidrug-resistant pneumococcal clone. BMC Biol. 12:49. [PubMed:24957517] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU