ICEberg ID | 811 |
Name | ICESluvan |
ICEO ID | ICEO_0000215 |
Organism | Streptococcus lutetiensis 5-F9 |
Size (bp) | 94189 |
GC content [Genome] (%) | 43.96 |
Insertion site | tRNA (uracil-5)-methyltransferase rumA; CACGTGGAGTGCGTAGTGTT(attL); TTCTCAAGGACCAGACAACA(attR) |
Function | glycopeptide and bacitracin resistance |
Species that ICE can be transferred to | - |
Nucleotide Sequence | HE963029 (complete ICE sequence in this GenBank file) |
Replicon | - |
Coordinates | 1..94189 |
Putative oriT region | coordinates: 44538..44565; oriTDB id: 200002 GGGAGTGGCTACACTCCCTATGCTTGCT |
Putative relaxase | coordinates: 42828..44156; Family: MOBP |
The graph information of ICESluvan components from HE963029 | |||||
Complete gene list of ICESluvan from HE963029 | |||||
# | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
1 | - | 9..176 [+], 168 | putative uncharacterized protein | ||
2 | - | 253..426 [+], 174 | putative uncharacterized protein | ||
3 | repA | 423..1241 [+], 819 | replication initiator protein | ||
4 | - | 1390..2745 [+], 1356 | cytosine-specific methyltransferase | ||
5 | - | 2729..3157 [+], 429 | putative uncharacterized protein | ||
6 | - | 3168..3551 [+], 384 | putative uncharacterized protein | ||
7 | - | 3560..3793 [+], 234 | putative uncharacterized protein | ||
8 | - | 3796..4380 [+], 585 | CAAX amino terminal protease self-immunity protein | ||
9 | - | 4421..4945 [+], 525 | putative uncharacterized protein | ||
10 | - | 6767..7021 [+], 255 | putative membrane protein | ||
11 | - | 7045..7899 [+], 855 | putative plasmid conjugal transfer protein,TrbL/VirB6 family | ||
12 | - | 7859..8314 [+], 456 | putative uncharacterized protein | ||
13 | - | 8292..10622 [+], 2331 | putative conjugal transfer protein | PrgJ, T4SS component | |
14 | - | 10624..13425 [+], 2802 | N-acetylmuramoyl L-alanine amidase | PrgK, T4SS component | |
15 | - | 13838..15037 [+], 1200 | putative uncharacterized protein | ||
16 | - | 15059..15271 [+], 213 | putative uncharacterized protein | ||
17 | - | 15346..15822 [+], 477 | putative uncharacterized protein | ||
18 | - | 15819..17513 [+], 1695 | putative conjugal transfer protein, TraG/TraD family | ||
19 | - | 17672..17920 [+], 249 | putative conjugal transfer protein | ||
20 | - | 18003..18875 [+], 873 | membrane protein, putative conjugative transfer protein | ||
21 | - | 18906..19448 [+], 543 | adenine-specific methyltransferase | ||
22 | - | 19462..19884 [+], 423 | putative uncharacterized protein | ||
23 | - | 19814..22213 [+], 2400 | putative conjugal transfer protein | ||
24 | - | 22245..24236 [+], 1992 | DNA-repair protein | Orf14_Tn, T4SS component | |
25 | - | 24259..24510 [+], 252 | putative uncharacterized protein | ||
26 | - | 24500..25729 [+], 1230 | putative bacteriocin | ||
27 | - | 25726..36520 [+], 10795 | DNA topoisomerase (pseudogene) | ||
28 | - | 27204..29066 [+], 1863 | TnpX site-specific recombinase | ||
29 | - | 29253..29549 [+], 297 | putative uncharacterized protein | ||
30 | - | 29680..30733 [+], 1054 | transposase, IS30 family (pseudogene) | ||
31 | - | 30982..31470 [+], 489 | putative VanZ family protein | ||
32 | - | 31555..31881 [+], 327 | putative uncharacterized protein | ||
33 | - | 32121..33629 [+], 1509 | putative mobilization protein, conjugal transfer protein | ||
34 | - | 33626..35527 [+], 1902 | putative DNA primase | ||
35 | - | 35646..35837 [+], 192 | putative uncharacterized protein | ||
36 | - | 36669..40589 [+], 3921 | putative uncharacterized protein, LtrC family | ||
37 | - | 40590..41534 [+], 945 | putative uncharacterized protein | ||
38 | - | 42041..42430 [-], 390 | putative uncharacterized protein | ||
39 | - | 42460..42816 [-], 357 | putative uncharacterized protein | ||
40 | - | 42828..44156 [-], 1329 | putative mobilization protein | Relaxase, MOBP Family | |
41 | - | 44117..44446 [-], 330 | putative mobilization protein, MobC | ||
42 | - | 44704..45075 [-], 372 | putative uncharacterized protein | ||
43 | - | 45220..45405 [+], 186 | transposase | ||
44 | - | 45563..45730 [+], 168 | putative uncharacterized protein | ||
45 | vanRB | 46349..47008 [+], 660 | response regulator VanRB | AR | |
46 | vanSB | 47011..48354 [+], 1344 | sensor protein, histidine kinase VanSB | AR | |
47 | vanYB | 48525..49331 [+], 807 | carboxypeptidase VanY | AR | |
48 | vanW | 49328..50176 [+], 849 | vancomycin resistance protein VanW | AR | |
49 | vanH | 50173..51144 [+], 972 | vancomycin resistance protein VanH | AR | |
50 | vanB | 51137..52165 [+], 1029 | vancomycin B-type resistance protein VanB2 | AR | |
51 | vanX | 52171..52779 [+], 609 | vancomycin B-type resistance protein VanX | AR | |
52 | - | 53022..53798 [+], 777 | putative uncharacterized protein | ||
53 | - | 53805..54038 [+], 234 | putative uncharacterized protein | ||
54 | - | 53960..54202 [-], 243 | putative uncharacterized protein | ||
55 | xis | 54462..54662 [+], 201 | excisionase | ||
56 | int | 54665..55939 [+], 1275 | integrase | Integrase | |
57 | - | 56862..57452 [-], 591 | putative abortive infection protein AbiGI | ||
58 | - | 57625..62520 [+], 4896 | agglutinin receptor | PrgB, T4SS component | |
59 | - | 62521..62712 [+], 192 | putative calcium-binding protein | ||
60 | - | 62696..63247 [+], 552 | putative uncharacterized protein | ||
61 | - | 70169..70468 [+], 300 | putative uncharacterized protein | ||
62 | - | 70482..70781 [+], 300 | putative uncharacterized protein | ||
63 | - | 71481..72686 [+], 1206 | putative uncharacterized phage related protein | T4CP | |
64 | - | 72683..74011 [+], 1329 | putative uncharacterized phage related protein | ||
65 | - | 75699..76337 [+], 639 | putative uncharacterized protein | ||
66 | - | 76377..77453 [+], 1077 | putative DNA primase | ||
67 | - | 77507..77734 [+], 228 | putative uncharacterized protein | ||
68 | - | 77731..78120 [+], 390 | putative uncharacterized protein | ||
69 | - | 78170..78460 [+], 291 | putative uncharacterized protein | ||
70 | - | 78500..79006 [+], 507 | putative antidote epsilon protein, zeta toxin regulator | ||
71 | - | 79006..79776 [+], 771 | putative zeta-toxin/signal recognition particle | ||
72 | - | 79808..82315 [+], 2508 | putative uncharacterized protein | ||
73 | - | 82636..82995 [+], 360 | putative uncharacterized protein | ||
74 | - | 83005..83370 [+], 366 | putative mobilisation protein, MobC family | ||
75 | - | 83357..85222 [+], 1866 | relaxase | ||
76 | - | 86634..87383 [+], 750 | ABC-type antimicrobial peptide transport system,ATPase component | ||
77 | - | 87396..89414 [+], 2019 | ABC-type antimicrobial peptide transport system,permease component | ||
78 | - | 89504..91078 [+], 1575 | histidine kinase | ||
79 | SalR | 91059..91655 [+], 597 | response regulator | ||
80 | - | 91761..91982 [+], 222 | transcriptional regulator, Cro/CI family |
(1) Bjorkeng EK; Hjerde E; Pedersen T; Sundsfjord A; Hegstad K (2013). ICESluvan, a 94-kilobase mosaic integrative conjugative element conferring interspecies transfer of VanB-type glycopeptide resistance, a novel bacitracin resistance locus, and a toxin-antitoxin stabilization system. J Bacteriol. 195(23):5381-90. [PubMed:24078615] |