![]() | 81 |
![]() ![]() | ICESpnMalM6 ![]() |
![]() | Streptococcus pneumoniae Mal M6 |
![]() | 23032 |
![]() | 38.49 |
![]() | - |
![]() | Tetracycline resistance |
![]() | - |
![]() | FR671413 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..23032 |
![]() ![]() | coordinates: 2166..2298; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 2309..3514; Gene: orf20; Family: MOBT |
The graph information of ICESpnMalM6 components from FR671413 | |||||
![]() | |||||
Complete gene list of ICESpnMalM6 from FR671413 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | orf23 | 1..315 [+], 315 | conjugative transposon protein | ||
2 | orf22 | 334..717 [+], 384 | conjugative transposon protein | ||
3 | orf21 | 746..2131 [+], 1386 | conjugative transposon FtsK/SpoIIIE-family protein | Orf21_Tn, T4SS component | |
4 | orf20 | 2309..3514 [+], 1206 | putative conjugative transposon replication initiation factor | Relaxase, MOBT Family | |
5 | orf19 | 3557..3778 [+], 222 | conjugative transposon protein | Orf19_Tn, T4SS component | |
6 | orf18 | 3895..4392 [+], 498 | conjugative transposon protein | ||
7 | orf17 | 4643..4873 [+], 231 | putative conjugative transposon membrane protein | Orf17_Tn, T4SS component | |
8 | orf16 | 4857..7304 [+], 2448 | conjugative transposon ATP/GTP-binding protein | Orf16_Tn, T4SS component | |
9 | orf15 | 7307..9484 [+], 2178 | conjugative transposon membrane protein | Orf15_Tn, T4SS component | |
10 | orf14 | 9481..10482 [+], 1002 | putative cell wall hydrolase | Orf14_Tn, T4SS component | |
11 | orf13 | 10497..11411 [+], 915 | putative conjugative transposon exported protein | Orf13_Tn, T4SS component | |
12 | tetM | 11788..13707 [+], 1920 | conjugative transposon tetracycline resistance protein | ||
13 | - | 13919..14316 [+], 398 | UmuC/MucB-like protein | ||
14 | - | 14313..14648 [+], 336 | ImsC-like protein | ||
15 | - | 14730..15029 [+], 300 | YolD domain protein | ||
16 | mel | 15433..16896 [-], 1464 | ABC transporter ATPase subunit | ||
17 | mef | 17016..18233 [-], 1218 | Macrolide efflux transporter | ||
18 | orf9 | 19562..19915 [-], 354 | putative conjugative transposon regulatory protein | ||
19 | SPN23F13061 | 20045..20191 [+], 147 | putative uncharacterized protein | ||
20 | orf7 | 20420..20842 [+], 423 | putative conjugative transposon regulatory protein | ||
21 | xis | 21530..21733 [+], 204 | excisionase | ||
22 | int | 21815..23032 [+], 1218 | Integrase | Integrase |
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] ![]() |
![]() |