ICEberg
I. Information of ICE
ICEberg ID81
Name ICESpnMalM6 This is a predicted ICE derived from literature
OrganismStreptococcus pneumoniae Mal M6
Size (bp)23032
GC content [Genome] (%)38.49
Insertion site-
FunctionTetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceFR671413 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..23032 
Putative oriT region coordinates: 2166..2298;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2309..3514; Gene: orf20;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpnMalM6 is not available.



The graph information of ICESpnMalM6 components from FR671413
Complete gene list of ICESpnMalM6 from FR671413
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1orf231..315 [+], 315conjugative transposon protein
2orf22334..717 [+], 384conjugative transposon protein
3orf21746..2131 [+], 1386conjugative transposon FtsK/SpoIIIE-family proteinOrf21_Tn, T4SS component 
4orf202309..3514 [+], 1206putative conjugative transposon replication initiation factorRelaxase, MOBT Family
5orf193557..3778 [+], 222conjugative transposon proteinOrf19_Tn, T4SS component 
6orf183895..4392 [+], 498conjugative transposon protein
7orf174643..4873 [+], 231putative conjugative transposon membrane proteinOrf17_Tn, T4SS component 
8orf164857..7304 [+], 2448conjugative transposon ATP/GTP-binding proteinOrf16_Tn, T4SS component 
9orf157307..9484 [+], 2178conjugative transposon membrane proteinOrf15_Tn, T4SS component 
10orf149481..10482 [+], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
11orf1310497..11411 [+], 915putative conjugative transposon exported proteinOrf13_Tn, T4SS component 
12tetM11788..13707 [+], 1920conjugative transposon tetracycline resistance protein
13-13919..14316 [+], 398UmuC/MucB-like protein
14-14313..14648 [+], 336ImsC-like protein
15-14730..15029 [+], 300YolD domain protein
16mel15433..16896 [-], 1464ABC transporter ATPase subunit
17mef17016..18233 [-], 1218Macrolide efflux transporter
18orf919562..19915 [-], 354putative conjugative transposon regulatory protein
19SPN23F1306120045..20191 [+], 147putative uncharacterized protein
20orf720420..20842 [+], 423putative conjugative transposon regulatory protein
21xis21530..21733 [+], 204excisionase
22int21815..23032 [+], 1218IntegraseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins22Fasta
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PubMed:21273480] experimental
 
experimental experimental literature