 ICEberg ID | 78 |
Name  | ICESt1  |
| ICEO ID | ICEO_0000118 |
| Organism | Streptococcus thermophilus CNRZ368 |
| Size (bp) | 35870 |
| GC content [Genome] (%) | 34.99 |
| Insertion site | fda |
| Function | Type II Restriction-Modification System |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | AJ278471 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1290..36049 |
| Putative oriT region | coordinates: 23370..23582; oriTDB id: 200004 GTTTTATTCTGGAAGGCAATAAATTTCAAGACCGTTTTCTCAATCTTGGGTCTACCCTTGAAGTCATGTT TAATGGGGATTTCCGTAATAAAACATTTGATAAACGGTTCATCACCTATGACATTGCCATCAACCGCATT GATAGCCGTATCACCATTAATGAGGTCGAGGTAAAGGGTTCTAAACTCCAACTTATGACAGACGTCACTT GGG |
| Putative relaxase | - |
The graph information of ICESt1 components from AJ278471 | |||||
 | |||||
| Complete gene list of ICESt1 from AJ278471 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 1752..2936 [-], 1185 | putative Abi-alpha protein | ||
| 2 | gst | 3491..4708 [+], 1218 | putative glutamate/aspartate-proton symport protein | ||
| 3 | - | 4728..5657 [+], 930 | putative carboxylate-amine/thiol ligase | ||
| 4 | - | 5841..7016 [-], 1176 | putative transposase | ||
| 5 | - | 9382..10515 [-], 1134 | putative ATP/GTP-binding protein | ||
| 6 | - | 10516..11286 [-], 771 | hypothetical protein | ||
| 7 | - | 11316..11339 [-], 24 | ORFV1 protein | ||
| 8 | - | 11774..12199 [+], 426 | hypothetical protein | ||
| 9 | - | 12382..14103 [-], 1722 | putative ATP/GTP-binding protein | ||
| 10 | - | 14462..14767 [+], 306 | hypothetical protein | ||
| 11 | sth368IR | 14837..16312 [-], 1476 | R.Sth368I endonuclease | ||
| 12 | sth368IM | 16428..17693 [+], 1266 | M.Sth368I methyltransferase | ||
| 13 | - | 17725..18024 [-], 300 | hypothetical protein | ||
| 14 | arp1 | 18017..18715 [-], 699 | hypothetical transcriptional regulator | ||
| 15 | - | 18724..19581 [-], 858 | hypothetical protein | ||
| 16 | - | 19679..20995 [-], 1317 | hypothetical protein | ||
| 17 | arp2 | 20985..21320 [-], 336 | hypothetical transcriptional regulator | ||
| 18 | - | 22183..22479 [+], 297 | hypothetical protein | ||
| 19 | - | 22501..22962 [+], 462 | hypothetical protein | OrfM; conjugative transfer; [PMID: 15073287] | |
| 20 | - | 22976..24664 [+], 1689 | putative transfer protein | YdcQ, T4SS component | |
| 21 | - | 24872..26104 [+], 1233 | putative transfer protein | OrfK; conjugative transfer; [PMID: 15073287] | |
| 22 | - | 26119..26349 [+], 231 | hypothetical protein | OrfJ; conjugative transfer; [PMID: 15073287] | |
| 23 | - | 26354..26911 [+], 558 | hypothetical protein | ||
| 24 | ORFH | 26414..26911 [+], 498 | hypothetical protein | OrfH; conjugative transfer; [PMID: 15073287] | |
| 25 | - | 26923..27918 [+], 996 | putative transfer protein | OrfG; conjugative transfer; [PMID: 15073287] | |
| 26 | - | 27928..28152 [+], 225 | hypothetical protein | OrfF; conjugative transfer; [PMID: 15073287] | |
| 27 | ORFE | 28155..28532 [+], 378 | putative transfer protein | YddD, T4SS component | |
| 28 | - | 28578..31082 [+], 2505 | putative ATP/GTP-binding protein | YddE, T4SS component | |
| 29 | - | 31094..32974 [+], 1881 | putative transmembrane protein | YddG, T4SS component | |
| 30 | - | 32976..33200 [+], 225 | hypothetical protein | ||
| 31 | - | 33226..34338 [+], 1113 | putative transfer protein | Orf13_p, T4SS component | |
| 32 | xis | 34352..34600 [+], 249 | excisionase | excisionase; [PMID: 15073287] | |
| 33 | int | 34600..35946 [+], 1347 | integrase | Integrase | |
| 34 | fda | 36030..36272 [-], 243 | putative fructose-1,6-biphosphate aldolase | ||
 Flanking regions |
|
(1) Carraro N; Libante V; Morel C; Decaris B; Charron-Bourgoin F; Leblond P; Guedon G (2011). Differential regulation of two closely related integrative and conjugative elements from Streptococcus thermophilus. BMC Microbiol. 0.623611111. [PubMed:22024428]
|
|
(2) Bellanger X; Roberts AP; Morel C; Choulet F; Pavlovic G; Mullany P; Decaris B; Guedon G (2009). Conjugative transfer of the integrative conjugative elements ICESt1 and ICESt3 from Streptococcus thermophilus. J Bacteriol. 191(8):2764-75. [PubMed:19181800]
|
|
(3) Bellanger X; Morel C; Decaris B; Guedon G (2008). Regulation of excision of integrative and potentially conjugative elements from Streptococcus thermophilus: role of the arp1 repressor. J Mol Microbiol Biotechnol. 14(1-3):16-21. [PubMed:17957106]
|
|
(4) Bellanger X; Morel C; Decaris B; Guedon G (2007). Derepression of excision of integrative and potentially conjugative elements from Streptococcus thermophilus by DNA damage response: implication of a cI-related repressor. J Bacteriol. 189(4):1478-81. [PubMed:17114247]
|
|
(5) Pavlovic G; Burrus V; Gintz B; Decaris B; Guedon G (2004). Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology. 150(Pt 4):759-74. [PubMed:15073287]
|
(6) Burrus V; Pavlovic G; Decaris B; Guedon G (2002). The ICESt1 element of Streptococcus thermophilus belongs to a large family of integrative and conjugative elements that exchange modules and change their specificity of integration. Plasmid. 48(2):77-97. [PubMed:12383726] 
|
|
(7) Burrus V; Bontemps C; Decaris B; Guedon G (2001). Characterization of a novel type II restriction-modification system, Sth368I, encoded by the integrative element ICESt1 of Streptococcus thermophilus CNRZ368. Appl Environ Microbiol. 67(4):1522-8. [PubMed:11282600]
|
|
(8) Burrus V; Roussel Y; Decaris B; Guedon G (2000). Characterization of a novel integrative element, ICESt1, in the lactic acid bacterium Streptococcus thermophilus. Appl Environ Microbiol. 66(4):1749-53. [PubMed:10742276]
|
| experimental literature |
| in silico analysis literature |