 ICEberg ID | 753 |
Name  | ICE_SsaT93_fda  |
| Organism | Streptococcus salivarius T93 |
| Size (bp) | 28,421 |
| GC content [Genome] (%) | 35.71 |
| Insertion site | fda |
| Function | - |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | LT622837 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..28421 |
| Putative oriT region | coordinates: 17011..17223; oriTDB id: 200003 GCCTGACTACAGGTCAGGCGCAGATCGTAGCCCGAAGTTCCTAGTCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA TGA |
| Putative relaxase | coordinates: 17224..18456; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaT93_fda components from LT622837 | |||||
 | |||||
| Complete gene list of ICE_SsaT93_fda from LT622837 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 923..3196 [-], 2274 | Putative permease protein | ||
| 2 | - | 3212..3886 [-], 675 | ABC transporter ATP-binding protein | ||
| 3 | - | 3895..4671 [-], 777 | hypothetical protein | ||
| 4 | avrD | 4661..5599 [-], 939 | Avirulence AvrD-like protein | ||
| 5 | - | 5716..6315 [-], 600 | Two-component system TCS response regulator | ||
| 6 | - | 6308..8080 [-], 1773 | Two-component system TCS Histidine kinase | ||
| 7 | - | 8867..9304 [-], 438 | hypothetical protein | ||
| 8 | - | 9456..9752 [-], 297 | hypothetical protein | ||
| 9 | arp1 | 9745..10443 [-], 699 | putative transcriptional regulator Arp1 | ||
| 10 | ORFQ | 10452..11312 [-], 861 | putative ImmA protease | ||
| 11 | - | 11525..12397 [-], 873 | hypothetical protein | ||
| 12 | - | 12661..13179 [-], 519 | hypothetical protein | ||
| 13 | arp2 | 13340..13681 [-], 342 | putative transcriptional regulator Arp2 | ||
| 14 | ORFO | 14249..14278 [+], 30 | conserved protein of unknown function | ||
| 15 | ORFN | 14313..14495 [+], 183 | conserved protein of unknown function | ||
| 16 | ORFM | 14535..14831 [+], 297 | Putative conjugal transfer protein | ||
| 17 | ORFL | 14853..15314 [+], 462 | Putative conjugal transfer protein | ||
| 18 | ORFK | 15328..17016 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
| 19 | ORFJ | 17224..18456 [+], 1233 | Putative relaxase | Relaxase, MOBT Family | |
| 20 | ORFI | 18471..18701 [+], 231 | Putative conjugal transfer protein | ||
| 21 | ORFH | 18706..19263 [+], 558 | Putative conjugal transfer protein | ||
| 22 | ORFG | 19275..20270 [+], 996 | Putative conjugal transfer protein | ||
| 23 | ORFF | 20280..20504 [+], 225 | Putative conjugal transfer protein | ||
| 24 | ORFE | 20507..20917 [+], 411 | Putative conjugal transfer protein | YddD, T4SS component | |
| 25 | ORFD | 20931..23435 [+], 2505 | Putative conjugal transfer protein | YddE, T4SS component | |
| 26 | ORFC | 23447..25327 [+], 1881 | Putative conjugal transfer protein | YddG, T4SS component | |
| 27 | ORFB | 25329..25553 [+], 225 | Putative conjugal transfer protein | ||
| 28 | ORFA | 25570..26682 [+], 1113 | Putative conjugal transfer protein | Orf13_p, T4SS component | |
| 29 | xis | 26696..26944 [+], 249 | Excisionase | ||
| 30 | int | 26944..28290 [+], 1347 | Tyrosine integrase | Integrase | |
 Gene may contribute to site-specific recombination |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] 
|
| experimental literature |
| in silico analysis literature |