ICEberg
I. Information of ICE
ICEberg ID752
Name ICE_SsaN5_fda This is a predicted ICE derived from literature
OrganismStreptococcus salivarius N5
Size (bp)25,974
GC content [Genome] (%)37.29
Insertion sitefda
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622835 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..25974 
Putative oriT region coordinates: 14613..14825;   oriTDB id:  200003
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGCCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATCAGAAGGAGGTGTTCCCA
TGA
Putative relaxase coordinates: 14826..16058; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaN5_fda is not available.



The graph information of ICE_SsaN5_fda components from LT622835
Complete gene list of ICE_SsaN5_fda from LT622835
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-647..1042 [-], 396hypothetical protein
2-1202..1945 [-], 744hypothetical protein
3-2999..3301 [+], 303hypothetical protein
4dcm3349..4632 [-], 1284Cytosine-specific methyltransferase
5-4632..5801 [-], 1170hypothetical protein
6-5880..6173 [-], 294hypothetical protein
7-6166..6468 [-], 303hypothetical protein
8-7072..7527 [-], 456hypothetical protein
9arp17542..8228 [-], 687putative transcriptional regulator Arp1
10ORFQ8237..9097 [-], 861putative ImmA protease
11-9288..10682 [-], 1395hypothetical protein
12-10741..10920 [-], 180DNA-binding helix-turn-helix protein
13arp210926..11267 [-], 342putative transcriptional regulator Arp2
14ORFO11851..11880 [+], 30conserved protein of unknown function
15ORFN11915..12097 [+], 183conserved protein of unknown function
16ORFM12136..12432 [+], 297Putative conjugal transfer protein
17ORFL12455..12916 [+], 462Putative conjugal transfer protein
18ORFK12930..14618 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
19ORFJ14826..16058 [+], 1233Putative relaxaseRelaxase, MOBT Family
20ORFI16072..16302 [+], 231Putative conjugal transfer protein
21ORFH16307..16864 [+], 558Putative conjugal transfer protein
22ORFG16876..17871 [+], 996Putative conjugal transfer protein
23ORFF17881..18105 [+], 225Putative conjugal transfer protein
24ORFE18108..18518 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
25ORFD18532..21036 [+], 2505-YddE, T4SS component 
26ORFC21048..22928 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
27ORFB22930..23154 [+], 225Putative conjugal transfer protein
28ORFA23171..24283 [+], 1113Putative conjugal transfer proteinOrf13_p, T4SS component 
29xis24297..24545 [+], 249Excisionase
30int24545..25891 [+], 1347Tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins30Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature