![]() | 752 |
![]() ![]() | ICE_SsaN5_fda ![]() |
![]() | Streptococcus salivarius N5 |
![]() | 25,974 |
![]() | 37.29 |
![]() | fda |
![]() | - |
![]() | - |
![]() | LT622835 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..25974 |
![]() ![]() | coordinates: 14613..14825; oriTDB id: 200003 GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGCCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATCAGAAGGAGGTGTTCCCA TGA |
![]() ![]() | coordinates: 14826..16058; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaN5_fda components from LT622835 | |||||
![]() | |||||
Complete gene list of ICE_SsaN5_fda from LT622835 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 647..1042 [-], 396 | hypothetical protein | ||
2 | - | 1202..1945 [-], 744 | hypothetical protein | ||
3 | - | 2999..3301 [+], 303 | hypothetical protein | ||
4 | dcm | 3349..4632 [-], 1284 | Cytosine-specific methyltransferase | ||
5 | - | 4632..5801 [-], 1170 | hypothetical protein | ||
6 | - | 5880..6173 [-], 294 | hypothetical protein | ||
7 | - | 6166..6468 [-], 303 | hypothetical protein | ||
8 | - | 7072..7527 [-], 456 | hypothetical protein | ||
9 | arp1 | 7542..8228 [-], 687 | putative transcriptional regulator Arp1 | ||
10 | ORFQ | 8237..9097 [-], 861 | putative ImmA protease | ||
11 | - | 9288..10682 [-], 1395 | hypothetical protein | ||
12 | - | 10741..10920 [-], 180 | DNA-binding helix-turn-helix protein | ||
13 | arp2 | 10926..11267 [-], 342 | putative transcriptional regulator Arp2 | ||
14 | ORFO | 11851..11880 [+], 30 | conserved protein of unknown function | ||
15 | ORFN | 11915..12097 [+], 183 | conserved protein of unknown function | ||
16 | ORFM | 12136..12432 [+], 297 | Putative conjugal transfer protein | ||
17 | ORFL | 12455..12916 [+], 462 | Putative conjugal transfer protein | ||
18 | ORFK | 12930..14618 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
19 | ORFJ | 14826..16058 [+], 1233 | Putative relaxase | Relaxase, MOBT Family | |
20 | ORFI | 16072..16302 [+], 231 | Putative conjugal transfer protein | ||
21 | ORFH | 16307..16864 [+], 558 | Putative conjugal transfer protein | ||
22 | ORFG | 16876..17871 [+], 996 | Putative conjugal transfer protein | ||
23 | ORFF | 17881..18105 [+], 225 | Putative conjugal transfer protein | ||
24 | ORFE | 18108..18518 [+], 411 | Putative conjugal transfer protein | YddD, T4SS component | |
25 | ORFD | 18532..21036 [+], 2505 | - | YddE, T4SS component | |
26 | ORFC | 21048..22928 [+], 1881 | Putative conjugal transfer protein | YddG, T4SS component | |
27 | ORFB | 22930..23154 [+], 225 | Putative conjugal transfer protein | ||
28 | ORFA | 23171..24283 [+], 1113 | Putative conjugal transfer protein | Orf13_p, T4SS component | |
29 | xis | 24297..24545 [+], 249 | Excisionase | ||
30 | int | 24545..25891 [+], 1347 | Tyrosine integrase | Integrase |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] ![]() ![]() |
![]() |
![]() |