 ICEberg ID | 750 |
Name  | ICE_SsaL64_fda  |
| Organism | Streptococcus salivarius L64 |
| Size (bp) | 25,797 |
| GC content [Genome] (%) | 37.21 |
| Insertion site | fda |
| Function | - |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | LT622834 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..25797 |
| Putative oriT region | coordinates: 14388..14600; oriTDB id: 200003 GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTGCCCA TGA |
| Putative relaxase | coordinates: 14601..15833; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaL64_fda components from LT622834 | |||||
 | |||||
| Complete gene list of ICE_SsaL64_fda from LT622834 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 418..1440 [-], 1023 | hypothetical protein | ||
| 2 | repA | 2791..3150 [-], 360 | RepA | ||
| 3 | - | 3359..3676 [+], 318 | hypothetical protein | ||
| 4 | - | 3906..4367 [-], 462 | hypothetical protein | ||
| 5 | - | 4399..5271 [-], 873 | hypothetical protein | ||
| 6 | dcm | 5283..7364 [-], 2082 | Cytosine-specific methyltransferase | ||
| 7 | arp1 | 7567..8253 [-], 687 | putative transcriptional regulator Arp1 | ||
| 8 | ORFQ | 8262..9122 [-], 861 | putative ImmA protease | ||
| 9 | - | 9218..10705 [-], 1488 | hypothetical protein | ||
| 10 | arp2 | 10705..11046 [-], 342 | putative transcriptional regulator Arp2 | ||
| 11 | ORFO | 11627..11656 [+], 30 | conserved protein of unknown function | ||
| 12 | ORFN | 11691..11873 [+], 183 | conserved protein of unknown function | ||
| 13 | ORFM | 11912..12208 [+], 297 | Putative conjugal transfer protein | ||
| 14 | ORFL | 12230..12691 [+], 462 | Putative conjugal transfer protein | ||
| 15 | ORFK | 12705..14393 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
| 16 | ORFJ | 14601..15833 [+], 1233 | Putative relaxase | Relaxase, MOBT Family | |
| 17 | ORFI | 15848..16078 [+], 231 | Putative conjugal transfer protein | ||
| 18 | ORFH | 16082..16639 [+], 558 | - | ||
| 19 | ORFG | 16651..17646 [+], 996 | Putative conjugal transfer protein | ||
| 20 | ORFF | 17656..17880 [+], 225 | Putative conjugal transfer protein | ||
| 21 | ORFE | 17883..18293 [+], 411 | Putative conjugal transfer protein | YddD, T4SS component | |
| 22 | ORFD | 18307..20811 [+], 2505 | Putative conjugal transfer protein | YddE, T4SS component | |
| 23 | ORFC | 20823..22703 [+], 1881 | Putative conjugal transfer protein | YddG, T4SS component | |
| 24 | ORFB | 22705..22929 [+], 225 | Putative conjugal transfer protein | ||
| 25 | ORFA | 22946..24058 [+], 1113 | Putative conjugal transfer protein | Orf13_p, T4SS component | |
| 26 | xis | 24072..24320 [+], 249 | Excisionase | ||
| 27 | int | 24320..25666 [+], 1347 | Tyrosine integrase | Integrase | |
 Gene may contribute to site-specific recombination |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] 
|
| experimental literature |
| in silico analysis literature |