ICEberg
I. Information of ICE
ICEberg ID749
Name ICE_SsaL60_rpsI This is a predicted ICE derived from literature
OrganismStreptococcus salivarius L60
Size (bp)31,357
GC content [Genome] (%)35.88
Insertion siterpsI
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622833 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..31357 
Putative oriT region coordinates: 18576..18788;   oriTDB id:  200003
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAATTGGGA
TTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCT
TGA
Putative relaxase coordinates: 18789..20021; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaL60_rpsI is not available.



The graph information of ICE_SsaL60_rpsI components from LT622833
Complete gene list of ICE_SsaL60_rpsI from LT622833
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-571..705 [-], 135hypothetical protein
2cadX751..1089 [-], 339Cadmium resistance accessory protein CadX
3cadD1101..1715 [-], 615Cadmium resistance CadD
4-2433..3050 [-], 618hypothetical protein
5-3374..3841 [+], 468hypothetical protein
6-4641..5663 [-], 1023hypothetical protein
7repA6351..6710 [-], 360RepA
8-6920..7237 [+], 318hypothetical protein
9-7467..7928 [-], 462hypothetical protein
10-7960..8832 [-], 873hypothetical protein
11dcm8844..10925 [-], 2082Cytosine-specific methyltransferase
12ORFQ11293..12159 [-], 867putative ImmA protease
13-12365..14620 [-], 2256hypothetical protein
14arp214889..15227 [-], 339Putative transcriptional regulator Arp2
15ORFO15815..15844 [+], 30conserved protein of unknown function
16ORFN15879..16061 [+], 183conserved protein of unknown function
17ORFM16100..16396 [+], 297Putative conjugal transfer protein
18ORFL16418..16879 [+], 462Putative conjugal transfer protein
19ORFK16893..18581 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
20ORFJ18789..20021 [+], 1233putative relaxaseRelaxase, MOBT Family
21ORFI20036..20266 [+], 231Putative conjugal transfer protein
22ORFH20271..20828 [+], 558Putative conjugal transfer protein
23ORFG20840..21835 [+], 996Putative conjugal transfer protein
24ORFF21845..22069 [+], 225Putative conjugal transfer protein
25ORFE22072..22482 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
26ORFD22496..25000 [+], 2505Putative conjugal transfer proteinYddE, T4SS component 
27ORFC25012..26892 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
28ORFB26894..27118 [+], 225Putative conjugal transfer protein
29ORFA27135..28256 [+], 1122Putative conjugal transfer proteinOrf13_p, T4SS component 
30-28559..29701 [+], 1143hypothetical protein
31xis29755..30027 [+], 273excisionase
32int30038..31246 [+], 1209IntegraseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins32Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU