![]() | 749 |
![]() ![]() | ICE_SsaL60_rpsI ![]() |
![]() | Streptococcus salivarius L60 |
![]() | 31,357 |
![]() | 35.88 |
![]() | rpsI |
![]() | - |
![]() | - |
![]() | LT622833 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..31357 |
![]() ![]() | coordinates: 18576..18788; oriTDB id: 200003 GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAATTGGGA TTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCT TGA |
![]() ![]() | coordinates: 18789..20021; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaL60_rpsI components from LT622833 | |||||
![]() | |||||
Complete gene list of ICE_SsaL60_rpsI from LT622833 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 571..705 [-], 135 | hypothetical protein | ||
2 | cadX | 751..1089 [-], 339 | Cadmium resistance accessory protein CadX | ||
3 | cadD | 1101..1715 [-], 615 | Cadmium resistance CadD | ||
4 | - | 2433..3050 [-], 618 | hypothetical protein | ||
5 | - | 3374..3841 [+], 468 | hypothetical protein | ||
6 | - | 4641..5663 [-], 1023 | hypothetical protein | ||
7 | repA | 6351..6710 [-], 360 | RepA | ||
8 | - | 6920..7237 [+], 318 | hypothetical protein | ||
9 | - | 7467..7928 [-], 462 | hypothetical protein | ||
10 | - | 7960..8832 [-], 873 | hypothetical protein | ||
11 | dcm | 8844..10925 [-], 2082 | Cytosine-specific methyltransferase | ||
12 | ORFQ | 11293..12159 [-], 867 | putative ImmA protease | ||
13 | - | 12365..14620 [-], 2256 | hypothetical protein | ||
14 | arp2 | 14889..15227 [-], 339 | Putative transcriptional regulator Arp2 | ||
15 | ORFO | 15815..15844 [+], 30 | conserved protein of unknown function | ||
16 | ORFN | 15879..16061 [+], 183 | conserved protein of unknown function | ||
17 | ORFM | 16100..16396 [+], 297 | Putative conjugal transfer protein | ||
18 | ORFL | 16418..16879 [+], 462 | Putative conjugal transfer protein | ||
19 | ORFK | 16893..18581 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
20 | ORFJ | 18789..20021 [+], 1233 | putative relaxase | Relaxase, MOBT Family | |
21 | ORFI | 20036..20266 [+], 231 | Putative conjugal transfer protein | ||
22 | ORFH | 20271..20828 [+], 558 | Putative conjugal transfer protein | ||
23 | ORFG | 20840..21835 [+], 996 | Putative conjugal transfer protein | ||
24 | ORFF | 21845..22069 [+], 225 | Putative conjugal transfer protein | ||
25 | ORFE | 22072..22482 [+], 411 | Putative conjugal transfer protein | YddD, T4SS component | |
26 | ORFD | 22496..25000 [+], 2505 | Putative conjugal transfer protein | YddE, T4SS component | |
27 | ORFC | 25012..26892 [+], 1881 | Putative conjugal transfer protein | YddG, T4SS component | |
28 | ORFB | 26894..27118 [+], 225 | Putative conjugal transfer protein | ||
29 | ORFA | 27135..28256 [+], 1122 | Putative conjugal transfer protein | Orf13_p, T4SS component | |
30 | - | 28559..29701 [+], 1143 | hypothetical protein | ||
31 | xis | 29755..30027 [+], 273 | excisionase | ||
32 | int | 30038..31246 [+], 1209 | Integrase | Integrase |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] ![]() ![]() |
![]() |
![]() |