ICEberg
I. Information of ICE
ICEberg ID748
Name ICE_SsaL50_rpsI This is a predicted ICE derived from literature
OrganismStreptococcus salivarius L50
Size (bp)27,447
GC content [Genome] (%)36.69
Insertion siterpsI
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622832 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..27447 
Putative oriT region coordinates: 15699..15911;   oriTDB id:  200003
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGG
TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATCAAAAGGAGGTGTTCCCA
TGA
Putative relaxase coordinates: 15912..17144; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaL50_rpsI is not available.



The graph information of ICE_SsaL50_rpsI components from LT622832
Complete gene list of ICE_SsaL50_rpsI from LT622832
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-217..999 [-], 783hypothetical protein
2-1143..1331 [+], 189hypothetical protein
3-2121..3335 [-], 1215Type II restriction-modification system restriction subunit
4-3344..3811 [-], 468hypothetical protein
5dcm4073..5617 [+], 1545Cytosine-specific methyltransferase
6-5850..7160 [+], 1311hypothetical protein
7-7397..7702 [+], 306hypothetical protein
8-8109..8408 [-], 300hypothetical protein
9arp18401..9102 [-], 702putative transcriptional regulator Arp1
10ORFQ9111..9971 [-], 861putative ImmA protease
11-10140..10196 [-], 57hypothetical protein
12-10403..11821 [-], 1419hypothetical protein
13-11818..12000 [-], 183DNA-binding helix-turn-helix protein
14arp212006..12347 [-], 342Putative transcriptional regulator Arp2
15ORFO12938..12967 [+], 30conserved protein of unknown function
16ORFN13002..13184 [+], 183conserved protein of unknown function
17ORFM13223..13519 [+], 297Putative conjugal transfer protein
18ORFL13541..14002 [+], 462Putative conjugal transfer protein
19ORFK14016..15704 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
20ORFJ15912..17144 [+], 1233Putative relaxaseRelaxase, MOBT Family
21ORFI17159..17389 [+], 231Putative conjugal transfer protein
22ORFH17394..17951 [+], 558Putative conjugal transfer protein
23ORFG17963..18958 [+], 996Putative conjugal transfer protein
24ORFF18968..19192 [+], 225-
25ORFE19195..19605 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
26ORFD19619..22123 [+], 2505Putative conjugal transfer proteinYddE, T4SS component 
27ORFC22135..24015 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
28ORFB24017..24241 [+], 225Putative conjugal transfer protein
29ORFA24258..25370 [+], 1113Putative conjugal transfer proteinOrf13_p, T4SS component 
30-25436..25711 [+], 276hypothetical protein
31xis25838..26110 [+], 273excisionase
32int26121..27335 [+], 1215tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins32Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU