 ICEberg ID | 748 |
Name  | ICE_SsaL50_rpsI  |
| Organism | Streptococcus salivarius L50 |
| Size (bp) | 27,447 |
| GC content [Genome] (%) | 36.69 |
| Insertion site | rpsI |
| Function | - |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | LT622832 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..27447 |
| Putative oriT region | coordinates: 15699..15911; oriTDB id: 200003 GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGG TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATCAAAAGGAGGTGTTCCCA TGA |
| Putative relaxase | coordinates: 15912..17144; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaL50_rpsI components from LT622832 | |||||
 | |||||
| Complete gene list of ICE_SsaL50_rpsI from LT622832 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 217..999 [-], 783 | hypothetical protein | ||
| 2 | - | 1143..1331 [+], 189 | hypothetical protein | ||
| 3 | - | 2121..3335 [-], 1215 | Type II restriction-modification system restriction subunit | ||
| 4 | - | 3344..3811 [-], 468 | hypothetical protein | ||
| 5 | dcm | 4073..5617 [+], 1545 | Cytosine-specific methyltransferase | ||
| 6 | - | 5850..7160 [+], 1311 | hypothetical protein | ||
| 7 | - | 7397..7702 [+], 306 | hypothetical protein | ||
| 8 | - | 8109..8408 [-], 300 | hypothetical protein | ||
| 9 | arp1 | 8401..9102 [-], 702 | putative transcriptional regulator Arp1 | ||
| 10 | ORFQ | 9111..9971 [-], 861 | putative ImmA protease | ||
| 11 | - | 10140..10196 [-], 57 | hypothetical protein | ||
| 12 | - | 10403..11821 [-], 1419 | hypothetical protein | ||
| 13 | - | 11818..12000 [-], 183 | DNA-binding helix-turn-helix protein | ||
| 14 | arp2 | 12006..12347 [-], 342 | Putative transcriptional regulator Arp2 | ||
| 15 | ORFO | 12938..12967 [+], 30 | conserved protein of unknown function | ||
| 16 | ORFN | 13002..13184 [+], 183 | conserved protein of unknown function | ||
| 17 | ORFM | 13223..13519 [+], 297 | Putative conjugal transfer protein | ||
| 18 | ORFL | 13541..14002 [+], 462 | Putative conjugal transfer protein | ||
| 19 | ORFK | 14016..15704 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
| 20 | ORFJ | 15912..17144 [+], 1233 | Putative relaxase | Relaxase, MOBT Family | |
| 21 | ORFI | 17159..17389 [+], 231 | Putative conjugal transfer protein | ||
| 22 | ORFH | 17394..17951 [+], 558 | Putative conjugal transfer protein | ||
| 23 | ORFG | 17963..18958 [+], 996 | Putative conjugal transfer protein | ||
| 24 | ORFF | 18968..19192 [+], 225 | - | ||
| 25 | ORFE | 19195..19605 [+], 411 | Putative conjugal transfer protein | YddD, T4SS component | |
| 26 | ORFD | 19619..22123 [+], 2505 | Putative conjugal transfer protein | YddE, T4SS component | |
| 27 | ORFC | 22135..24015 [+], 1881 | Putative conjugal transfer protein | YddG, T4SS component | |
| 28 | ORFB | 24017..24241 [+], 225 | Putative conjugal transfer protein | ||
| 29 | ORFA | 24258..25370 [+], 1113 | Putative conjugal transfer protein | Orf13_p, T4SS component | |
| 30 | - | 25436..25711 [+], 276 | hypothetical protein | ||
| 31 | xis | 25838..26110 [+], 273 | excisionase | ||
| 32 | int | 26121..27335 [+], 1215 | tyrosine integrase | Integrase | |
 Gene may contribute to site-specific recombination |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] 
|
| experimental literature |
| in silico analysis literature |