![]() | 747 |
![]() ![]() | ICE_SsaL22_fda ![]() |
![]() | Streptococcus salivarius L22 |
![]() | 37,240 |
![]() | 35.06 |
![]() | fda |
![]() | - |
![]() | - |
![]() | LT622831 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..37240 |
![]() ![]() | coordinates: 24205..24417; oriTDB id: 200003 GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATTAAAAGGAGGTGTTCCTA TGA |
![]() ![]() | coordinates: 24418..25650; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaL22_fda components from LT622831 | |||||
![]() | |||||
Complete gene list of ICE_SsaL22_fda from LT622831 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | slvF | 713..1390 [+], 678 | Putative lantibiotic transport ATP-binding protein SlvF | ||
2 | slvE | 1392..2120 [+], 729 | Putative lantibiotic transport membrane protein SlvE | ||
3 | slvG | 2107..2757 [+], 651 | Putative lantibiotic transport protein SlvG | ||
4 | tnp | 3615..4196 [-], 582 | transposase | ||
5 | slvK | 4986..6323 [-], 1338 | Putative sensor histidine kinase SlvK | ||
6 | slvR | 6316..7002 [-], 687 | Putative response regulator SlvR | ||
7 | slvP | 6995..8593 [-], 1599 | Putative serine protease SlvP | ||
8 | slvI | 8595..9329 [-], 735 | Putative immunity protein SlvI | ||
9 | slvC | 9342..10562 [-], 1221 | Putative lantibiotic cyclase SlvC | ||
10 | slvT | 10519..12357 [-], 1839 | Putative ABC transporter SlvT | ||
11 | slvB | 12367..15321 [-], 2955 | Putative lantibiotic dehydratase SlvB | ||
12 | slvN | 15433..15594 [-], 162 | Salivaricin N | ||
13 | slvD | 15837..16010 [-], 174 | Salivaricin D | ||
14 | slvD | 16207..16380 [-], 174 | Salivaricin D | ||
15 | tnp | 16756..16917 [+], 162 | transposase, partial | ||
16 | tnp | 17027..17188 [+], 162 | transposase, partial | ||
17 | tnp | 17341..17610 [+], 270 | transposase, partial | ||
18 | arp1 | 17811..18509 [-], 699 | putative transcriptional regulator Arp1 | ||
19 | ORFQ | 18518..19378 [-], 861 | putative ImmA protease | ||
20 | - | 19493..20530 [-], 1038 | hypothetical protein | ||
21 | arp2 | 20514..20855 [-], 342 | Putative transcriptional regulator Arp2 | ||
22 | ORFO | 21444..21473 [+], 30 | conserved protein of unknown function | ||
23 | ORFN | 21508..21690 [+], 183 | conserved protein of unknown function | ||
24 | ORFM | 21729..22025 [+], 297 | Putative conjugal transfer protein | ||
25 | ORFL | 22047..22508 [+], 462 | Putative conjugal transfer protein | ||
26 | ORFK | 22522..24210 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
27 | ORFJ | 24418..25650 [+], 1233 | Putative relaxase | Relaxase, MOBT Family | |
28 | ORFI | 25665..25895 [+], 231 | Putative conjugal transfer protein | ||
29 | ORFH | 25900..26457 [+], 558 | Putative conjugal transfer protein | ||
30 | ORFG | 26469..27464 [+], 996 | Putative conjugal transfer protein | ||
31 | ORFF | 27474..27698 [+], 225 | Putative conjugal transfer protein | ||
32 | ORFE | 27701..28111 [+], 411 | Putative conjugal transfer protein | YddD, T4SS component | |
33 | ORFD | 28125..30629 [+], 2505 | - | YddE, T4SS component | |
34 | ORFC | 30641..32521 [+], 1881 | Putative conjugal transfer protein | YddG, T4SS component | |
35 | ORFB | 32523..32747 [+], 225 | Putative conjugal transfer protein | ||
36 | ORFA | 32764..33876 [+], 1113 | Putative conjugal transfer protein | Orf13_p, T4SS component | |
37 | - | 33977..35179 [+], 1203 | hypothetical protein | ||
38 | xis | 35563..35811 [+], 249 | Excisionase | ||
39 | int | 35811..37157 [+], 1347 | Tyrosine integrase | Integrase |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] ![]() ![]() |
![]() |
![]() |