![]() | 746 |
![]() ![]() | ICE_SsaF6-1_rpsI ![]() |
![]() | Streptococcus salivarius F6-1 |
![]() | 32,421 |
![]() | 34.86 |
![]() | rpsI |
![]() | - |
![]() | - |
![]() | LT622830 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..32421 |
![]() ![]() | coordinates: 21125..21337; oriTDB id: 200003 GCCTGACCTGTGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCAAAAGTGCCACATCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA TGA |
![]() ![]() | coordinates: 21338..22570; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaF6-1_rpsI components from LT622830 | |||||
![]() | |||||
Complete gene list of ICE_SsaF6-1_rpsI from LT622830 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | tnp | 192..725 [-], 534 | Transposase | ||
2 | - | 855..1472 [-], 618 | hypothetical protein | ||
3 | - | 1796..2263 [+], 468 | hypothetical protein | ||
4 | - | 3061..4083 [-], 1023 | hypothetical protein | ||
5 | - | 4704..5450 [-], 747 | hypothetical protein | ||
6 | - | 5470..6699 [-], 1230 | hypothetical protein | ||
7 | - | 6708..7298 [-], 591 | hypothetical protein | ||
8 | fabF | 7295..8509 [-], 1215 | 3-oxoacyl-[acyl-carrier-protein] synthase 2 | ||
9 | - | 8506..10617 [-], 2112 | hypothetical protein | ||
10 | - | 10604..11293 [-], 690 | hypothetical protein | ||
11 | - | 11309..12424 [-], 1116 | Methionine biosynthesis protein MetW-like protein | ||
12 | - | 12434..13867 [-], 1434 | Putative 8-amino-7-oxononanoate synthase | ||
13 | arp1 | 14700..15398 [-], 699 | putative transcriptional regulator Arp1 | ||
14 | - | 15408..16268 [-], 861 | hypothetical protein | ||
15 | - | 16401..17450 [-], 1050 | hypothetical protein | ||
16 | arp2 | 17447..17785 [-], 339 | putative transcriptional regulator Arp2 | ||
17 | ORFO | 18364..18393 [+], 30 | conserved protein of unknown function | ||
18 | ORFN | 18428..18610 [+], 183 | conserved protein of unknown function | ||
19 | - | 18649..18945 [+], 297 | putative conjugal transfer protein | ||
20 | ORFL | 18967..19428 [+], 462 | putative conjugal transfer protein | ||
21 | ORFK | 19442..21130 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
22 | ORFJ | 21338..22570 [+], 1233 | putative relaxase | Relaxase, MOBT Family | |
23 | ORFI | 22585..22815 [+], 231 | putative conjugal transfer protein | ||
24 | ORFH | 22820..23377 [+], 558 | - | ||
25 | ORFG | 23389..24384 [+], 996 | putative conjugal transfer protein | ||
26 | ORFF | 24394..24618 [+], 225 | putative conjugal transfer protein | ||
27 | ORFE | 24621..25031 [+], 411 | putative conjugal transfer protein | YddD, T4SS component | |
28 | ORFD | 25045..27549 [+], 2505 | putative conjugal transfer protein | YddE, T4SS component | |
29 | ORFC | 27561..29441 [+], 1881 | putative conjugal transfer protein | YddG, T4SS component | |
30 | ORFB | 29443..29667 [+], 225 | putative conjugal transfer protein | ||
31 | ORFA | 29684..30796 [+], 1113 | putative conjugal transfer protein | Orf13_p, T4SS component | |
32 | xis | 30810..31082 [+], 273 | Excisionase | ||
33 | int | 31095..32312 [+], 1218 | tyrosine recombinase | Integrase |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] ![]() ![]() |
![]() |
![]() |