ICEberg
I. Information of ICE
ICEberg ID746
Name ICE_SsaF6-1_rpsI This is a predicted ICE derived from literature
OrganismStreptococcus salivarius F6-1
Size (bp)32,421
GC content [Genome] (%)34.86
Insertion siterpsI
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622830 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..32421 
Putative oriT region coordinates: 21125..21337;   oriTDB id:  200003
GCCTGACCTGTGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCAAAAGTGCCACATCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA
TGA
Putative relaxase coordinates: 21338..22570; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaF6-1_rpsI is not available.



The graph information of ICE_SsaF6-1_rpsI components from LT622830
Complete gene list of ICE_SsaF6-1_rpsI from LT622830
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1tnp192..725 [-], 534Transposase
2-855..1472 [-], 618hypothetical protein
3-1796..2263 [+], 468hypothetical protein
4-3061..4083 [-], 1023hypothetical protein
5-4704..5450 [-], 747hypothetical protein
6-5470..6699 [-], 1230hypothetical protein
7-6708..7298 [-], 591hypothetical protein
8fabF7295..8509 [-], 12153-oxoacyl-[acyl-carrier-protein] synthase 2
9-8506..10617 [-], 2112hypothetical protein
10-10604..11293 [-], 690hypothetical protein
11-11309..12424 [-], 1116Methionine biosynthesis protein MetW-like protein
12-12434..13867 [-], 1434Putative 8-amino-7-oxononanoate synthase
13arp114700..15398 [-], 699putative transcriptional regulator Arp1
14-15408..16268 [-], 861hypothetical protein
15-16401..17450 [-], 1050hypothetical protein
16arp217447..17785 [-], 339putative transcriptional regulator Arp2
17ORFO18364..18393 [+], 30conserved protein of unknown function
18ORFN18428..18610 [+], 183conserved protein of unknown function
19-18649..18945 [+], 297putative conjugal transfer protein
20ORFL18967..19428 [+], 462putative conjugal transfer protein
21ORFK19442..21130 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
22ORFJ21338..22570 [+], 1233putative relaxaseRelaxase, MOBT Family
23ORFI22585..22815 [+], 231putative conjugal transfer protein
24ORFH22820..23377 [+], 558-
25ORFG23389..24384 [+], 996putative conjugal transfer protein
26ORFF24394..24618 [+], 225putative conjugal transfer protein
27ORFE24621..25031 [+], 411putative conjugal transfer proteinYddD, T4SS component 
28ORFD25045..27549 [+], 2505putative conjugal transfer proteinYddE, T4SS component 
29ORFC27561..29441 [+], 1881putative conjugal transfer proteinYddG, T4SS component 
30ORFB29443..29667 [+], 225putative conjugal transfer protein
31ORFA29684..30796 [+], 1113putative conjugal transfer proteinOrf13_p, T4SS component 
32xis30810..31082 [+], 273Excisionase
33int31095..32312 [+], 1218tyrosine recombinaseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins33Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU