ICEberg
I. Information of ICE
ICEberg ID745
Name ICE_SsaF4-2_fda This ICE is derived from experimental literature
ICEO ID ICEO_0000218
OrganismStreptococcus salivarius F4-2
Size (bp)30,222
GC content [Genome] (%)35.61
Insertion sitefda
Function-
Species that ICE can be transferred toStreptococcus salivarius; Streptococcus thermophilus; Enterococcus faecalis
Nucleotide SequenceLT622829 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..30222 
Putative oriT region coordinates: 18814..19026;   oriTDB id:  200003
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAGGATTTAGAAAGTGTGTCACTTTAGTTCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA
TGA
Putative relaxase coordinates: 19027..20259; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaF4-2_fda is not available.



The graph information of ICE_SsaF4-2_fda components from LT622829
Complete gene list of ICE_SsaF4-2_fda from LT622829
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-613..1974 [-], 1362hypothetical protein
2-2271..4079 [+], 1809hypothetical protein
3-4572..5321 [-], 750hypothetical protein
4-5311..6090 [-], 780hypothetical protein
5-6345..7028 [-], 684hypothetical protein
6-7541..7840 [+], 300hypothetical protein
7-8131..8592 [-], 462hypothetical protein
8-8624..9496 [-], 873hypothetical protein
9dcm9508..11589 [-], 2082Cytosine-specific methyltransferase
10arp111792..12478 [-], 687Putative transcriptional regulator Arp1
11ORFQ12482..13348 [-], 867putative ImmA protease
12-13863..15116 [-], 1254hypothetical protein
13arp215124..15468 [-], 345Putative transcriptional regulator Arp2
14ORFO16053..16082 [+], 30conserved protein of unknown function
15ORFN16117..16299 [+], 183conserved protein of unknown function
16ORFM16338..16634 [+], 297Putative conjugal transfer protein
17ORFL16656..17117 [+], 462Putative conjugal transfer protein
18ORFK17131..18819 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
19ORFJ19027..20259 [+], 1233Putative relaxaseRelaxase, MOBT Family
20ORFI20273..20503 [+], 231Putative conjugal transfer protein
21ORFH20508..21065 [+], 558Putative conjugal transfer protein
22ORFG21076..22071 [+], 996Putative conjugal transfer protein
23ORFF22081..22305 [+], 225Putative conjugal transfer protein
24ORFE22308..22718 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
25ORFD22732..25236 [+], 2505Putative conjugal transfer proteinYddE, T4SS component 
26ORFC25248..27128 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
27ORFB27130..27354 [+], 225Putative conjugal transfer protein
28ORFA27371..28483 [+], 1113Putative conjugal transfer proteinOrf13_p, T4SS component 
29xis28497..28745 [+], 249Excisionase
30int28745..30091 [+], 1347Tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins30Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU