 ICEberg ID | 745 |
Name  | ICE_SsaF4-2_fda  |
| ICEO ID | ICEO_0000218 |
| Organism | Streptococcus salivarius F4-2 |
| Size (bp) | 30,222 |
| GC content [Genome] (%) | 35.61 |
| Insertion site | fda |
| Function | - |
| Species that ICE can be transferred to | Streptococcus salivarius; Streptococcus thermophilus; Enterococcus faecalis |
| Nucleotide Sequence | LT622829 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..30222 |
| Putative oriT region | coordinates: 18814..19026; oriTDB id: 200003 GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAGGATTTAGAAAGTGTGTCACTTTAGTTCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA TGA |
| Putative relaxase | coordinates: 19027..20259; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaF4-2_fda components from LT622829 | |||||
 | |||||
| Complete gene list of ICE_SsaF4-2_fda from LT622829 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 613..1974 [-], 1362 | hypothetical protein | ||
| 2 | - | 2271..4079 [+], 1809 | hypothetical protein | ||
| 3 | - | 4572..5321 [-], 750 | hypothetical protein | ||
| 4 | - | 5311..6090 [-], 780 | hypothetical protein | ||
| 5 | - | 6345..7028 [-], 684 | hypothetical protein | ||
| 6 | - | 7541..7840 [+], 300 | hypothetical protein | ||
| 7 | - | 8131..8592 [-], 462 | hypothetical protein | ||
| 8 | - | 8624..9496 [-], 873 | hypothetical protein | ||
| 9 | dcm | 9508..11589 [-], 2082 | Cytosine-specific methyltransferase | ||
| 10 | arp1 | 11792..12478 [-], 687 | Putative transcriptional regulator Arp1 | ||
| 11 | ORFQ | 12482..13348 [-], 867 | putative ImmA protease | ||
| 12 | - | 13863..15116 [-], 1254 | hypothetical protein | ||
| 13 | arp2 | 15124..15468 [-], 345 | Putative transcriptional regulator Arp2 | ||
| 14 | ORFO | 16053..16082 [+], 30 | conserved protein of unknown function | ||
| 15 | ORFN | 16117..16299 [+], 183 | conserved protein of unknown function | ||
| 16 | ORFM | 16338..16634 [+], 297 | Putative conjugal transfer protein | ||
| 17 | ORFL | 16656..17117 [+], 462 | Putative conjugal transfer protein | ||
| 18 | ORFK | 17131..18819 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
| 19 | ORFJ | 19027..20259 [+], 1233 | Putative relaxase | Relaxase, MOBT Family | |
| 20 | ORFI | 20273..20503 [+], 231 | Putative conjugal transfer protein | ||
| 21 | ORFH | 20508..21065 [+], 558 | Putative conjugal transfer protein | ||
| 22 | ORFG | 21076..22071 [+], 996 | Putative conjugal transfer protein | ||
| 23 | ORFF | 22081..22305 [+], 225 | Putative conjugal transfer protein | ||
| 24 | ORFE | 22308..22718 [+], 411 | Putative conjugal transfer protein | YddD, T4SS component | |
| 25 | ORFD | 22732..25236 [+], 2505 | Putative conjugal transfer protein | YddE, T4SS component | |
| 26 | ORFC | 25248..27128 [+], 1881 | Putative conjugal transfer protein | YddG, T4SS component | |
| 27 | ORFB | 27130..27354 [+], 225 | Putative conjugal transfer protein | ||
| 28 | ORFA | 27371..28483 [+], 1113 | Putative conjugal transfer protein | Orf13_p, T4SS component | |
| 29 | xis | 28497..28745 [+], 249 | Excisionase | ||
| 30 | int | 28745..30091 [+], 1347 | Tyrosine integrase | Integrase | |
 Gene may contribute to site-specific recombination |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] 
|
| experimental literature |
| in silico analysis literature |