![]() | 744 |
![]() ![]() | ICE_SsaF1-8_rpmG ![]() |
![]() | Streptococcus salivarius F1-8 |
![]() | 27,272 |
![]() | 36.29 |
![]() | rpmG |
![]() | - |
![]() | - |
![]() | LT622828 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..27272 |
![]() ![]() | coordinates: 14062..14274; oriTDB id: 200004 GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAAACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA TGA |
![]() ![]() | coordinates: 14275..15507; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaF1-8_rpmG components from LT622828 | |||||
![]() | |||||
Complete gene list of ICE_SsaF1-8_rpmG from LT622828 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 164..1084 [-], 921 | hypothetical protein | ||
2 | - | 1074..1853 [-], 780 | hypothetical protein | ||
3 | - | 2128..2781 [-], 654 | hypothetical protein | ||
4 | - | 3225..3524 [+], 300 | hypothetical protein | ||
5 | - | 3814..4275 [-], 462 | hypothetical protein | ||
6 | - | 4307..5179 [-], 873 | hypothetical protein | ||
7 | dcm | 5191..7272 [-], 2082 | Cytosine-specific methyltransferase | ||
8 | arp1 | 7475..8161 [-], 687 | putative transcriptional regulator Arp1 | ||
9 | ORFQ | 8171..9031 [-], 861 | putative ImmA protease | ||
10 | - | 9122..10363 [-], 1242 | hypothetical protein | ||
11 | arp2 | 10372..10719 [-], 348 | Putative transcriptional regulator Arp2 | ||
12 | ORFO | 11301..11330 [+], 30 | conserved protein of unknown function | ||
13 | ORFN | 11365..11547 [+], 183 | conserved protein of unknown function | ||
14 | ORFM | 11586..11882 [+], 297 | Putative conjugal transfer protein | ||
15 | ORFL | 11904..12365 [+], 462 | Putative conjugal transfer protein | ||
16 | ORFK | 12379..14067 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
17 | ORFJ | 14275..15507 [+], 1233 | - | Relaxase, MOBT Family | |
18 | ORFI | 15522..15752 [+], 231 | Putative conjugal transfer protein | ||
19 | ORFH | 15756..16313 [+], 558 | Putative conjugal transfer protein | ||
20 | ORFG | 16325..17320 [+], 996 | Putative conjugal transfer protein | ||
21 | ORFF | 17330..17554 [+], 225 | Putative conjugal transfer protein | ||
22 | ORFE | 17557..17967 [+], 411 | Putative conjugal transfer protein | YddD, T4SS component | |
23 | ORFD | 17981..20485 [+], 2505 | Putative conjugal transfer protein | YddE, T4SS component | |
24 | ORFC | 20497..22377 [+], 1881 | Putative conjugal transfer protein | YddG, T4SS component | |
25 | ORFB | 22379..22603 [+], 225 | Putative conjugal transfer protein | ||
26 | ORFA | 22620..23732 [+], 1113 | Putative conjugal transfer protein | Orf13_p, T4SS component | |
27 | xis | 23746..24003 [+], 258 | Putative excisionase | ||
28 | int | 24014..25285 [+], 1272 | tyrosine integrase | Integrase | |
29 | - | 25653..26240 [+], 588 | hypothetical protein | ||
30 | - | 26254..26598 [+], 345 | hypothetical protein | ||
31 | secB | 26599..27033 [+], 435 | Preprotein translocase, SecB subunit |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] ![]() ![]() |
![]() |
![]() |