![]() | 743 |
![]() ![]() | ICE_SsaF1-4_fda ![]() |
![]() ![]() | ICEO_0000217 |
![]() | Streptococcus salivarius F1-4 |
![]() | 29,716 |
![]() | 35.33 |
![]() | fda |
![]() | - |
![]() | Streptococcus salivarius; Streptococcus thermophilus; Enterococcus faecalis |
![]() | LT622827 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..29716 |
![]() ![]() | coordinates: 18355..18567; oriTDB id: 200003 GCCTGACCAAAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA TGA |
![]() ![]() | coordinates: 18568..19800; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaF1-4_fda components from LT622827 | |||||
![]() | |||||
Complete gene list of ICE_SsaF1-4_fda from LT622827 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 597..1973 [-], 1377 | hypothetical protein | ||
2 | - | 2261..4069 [+], 1809 | - | ||
3 | - | 4167..4466 [+], 300 | hypothetical protein | ||
4 | LfaORFAP | 4729..6156 [-], 1428 | Type II restriction-modification system restriction subunit | ||
5 | LfaORFBP | 6164..7204 [-], 1041 | Type II restriction-modification system restriction subunit | ||
6 | - | 7194..7910 [-], 717 | hypothetical protein | ||
7 | dcm_2 | 7994..9022 [-], 1029 | Cytosine-5-methyltransferase | ||
8 | dcm_1 | 9012..10085 [-], 1074 | Cytosine-specific methyltransferase | ||
9 | - | 10082..10294 [-], 213 | putative transcriptional regulator, XRE family | ||
10 | - | 10447..10755 [-], 309 | hypothetical protein | ||
11 | arp1 | 10748..11449 [-], 702 | putative transcriptional regulator Arp1 | ||
12 | ORFQ | 11458..12318 [-], 861 | putative ImmA protease | ||
13 | - | 13465..14418 [-], 954 | hypothetical protein | ||
14 | - | 14473..14655 [-], 183 | XRE family transcriptional regulator | ||
15 | arp2 | 14661..15002 [-], 342 | Putative transcriptional regulator Arp2 | ||
16 | ORFO | 15593..15622 [+], 30 | Conserved protein of unknown function | ||
17 | ORFN | 15657..15839 [+], 183 | Conserved protein of unknown function | ||
18 | ORFM | 15878..16174 [+], 297 | putative conjugal transfer protein | ||
19 | ORFL | 16197..16658 [+], 462 | putative conjugal transfer protein | ||
20 | ORFK | 16672..18360 [+], 1689 | FtsK-SpoIIIE family coupling protein | YdcQ, T4SS component | |
21 | ORFJ | 18568..19800 [+], 1233 | Putative relaxase | Relaxase, MOBT Family | |
22 | ORFI | 19814..20044 [+], 231 | putative conjugal transfer protein | ||
23 | ORFH | 20049..20606 [+], 558 | putative conjugal transfer protein | ||
24 | ORFG | 20618..21613 [+], 996 | putative conjugal transfer protein | ||
25 | ORFF | 21623..21847 [+], 225 | putative conjugal transfer protein | ||
26 | ORFE | 21850..22260 [+], 411 | putative conjugal transfer protein | YddD, T4SS component | |
27 | ORFD | 22274..24778 [+], 2505 | putative conjugal transfer protein | YddE, T4SS component | |
28 | ORFC | 24790..26670 [+], 1881 | putative conjugal transfer protein | YddG, T4SS component | |
29 | ORFB | 26672..26896 [+], 225 | putative conjugal transfer protein | ||
30 | ORFA | 26913..28025 [+], 1113 | putative conjugal transfer protein | Orf13_p, T4SS component | |
31 | xis | 28039..28287 [+], 249 | Excisionase | ||
32 | int | 28287..29633 [+], 1347 | Tyrosine integrase | Integrase |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] ![]() ![]() |
![]() |
![]() |