ICEberg
I. Information of ICE
ICEberg ID742
Name ICE_SsaB57_fda This is a predicted ICE derived from literature
OrganismStreptococcus salivarius B57
Size (bp)26,451
GC content [Genome] (%)36.71
Insertion sitefda
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622826 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..26451 
Putative oriT region coordinates: 14120..14308;   oriTDB id:  200003
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTT
Putative relaxase coordinates: 14355..15596; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaB57_fda is not available.



The graph information of ICE_SsaB57_fda components from LT622826
Complete gene list of ICE_SsaB57_fda from LT622826
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-471..1901 [-], 1431hypothetical protein
2bsoBIM2515..4017 [-], 1503Modification methylase BsoBI
3bsoBIR4021..4983 [-], 963Type-2 restriction enzyme BsoBI
4-5451..6641 [-], 1191hypothetical protein
5-6896..7195 [-], 300hypothetical protein
6arp17188..7886 [-], 699putative transcriptional regulator Arp1
7ORFQ7896..8756 [-], 861putative ImmA protease
8-8851..10434 [-], 1584hypothetical protein
9arp210434..10775 [-], 342putative transcriptional regulator Arp2
10ORFO11359..11388 [+], 30conserved protein of unknown function
11ORFN11423..11605 [+], 183conserved protein of unknown function
12ORFM11644..11940 [+], 297Putative conjugal transfer protein
13ORFL11962..12423 [+], 462Putative conjugal transfer protein
14ORFK12437..14125 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
15ORFJ14355..15596 [+], 1242Putative relaxaseRelaxase, MOBT Family
16ORFI15611..15841 [+], 231Putative conjugal transfer protein
17ORFH15845..16402 [+], 558Putative conjugal transfer protein
18ORFG16414..17409 [+], 996Putative conjugal transfer protein
19ORFF17419..17643 [+], 225Putative conjugal transfer protein
20ORFE17646..18056 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
21ORFD18070..20574 [+], 2505Putative conjugal transfer proteinYddE, T4SS component 
22ORFC20586..22466 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
23ORFB22468..22692 [+], 225Putative conjugal transfer protein
24ORFA22709..23821 [+], 1113Putative conjugal transfer proteinOrf13_p, T4SS component 
25-23880..24506 [+], 627hypothetical protein
26xis24730..24978 [+], 249Excisionase
27int24978..26324 [+], 1347Tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins27Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature