![]() | 742 |
![]() ![]() | ICE_SsaB57_fda ![]() |
![]() | Streptococcus salivarius B57 |
![]() | 26,451 |
![]() | 36.71 |
![]() | fda |
![]() | - |
![]() | - |
![]() | LT622826 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..26451 |
![]() ![]() | coordinates: 14120..14308; oriTDB id: 200003 GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTT |
![]() ![]() | coordinates: 14355..15596; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaB57_fda components from LT622826 | |||||
![]() | |||||
Complete gene list of ICE_SsaB57_fda from LT622826 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 471..1901 [-], 1431 | hypothetical protein | ||
2 | bsoBIM | 2515..4017 [-], 1503 | Modification methylase BsoBI | ||
3 | bsoBIR | 4021..4983 [-], 963 | Type-2 restriction enzyme BsoBI | ||
4 | - | 5451..6641 [-], 1191 | hypothetical protein | ||
5 | - | 6896..7195 [-], 300 | hypothetical protein | ||
6 | arp1 | 7188..7886 [-], 699 | putative transcriptional regulator Arp1 | ||
7 | ORFQ | 7896..8756 [-], 861 | putative ImmA protease | ||
8 | - | 8851..10434 [-], 1584 | hypothetical protein | ||
9 | arp2 | 10434..10775 [-], 342 | putative transcriptional regulator Arp2 | ||
10 | ORFO | 11359..11388 [+], 30 | conserved protein of unknown function | ||
11 | ORFN | 11423..11605 [+], 183 | conserved protein of unknown function | ||
12 | ORFM | 11644..11940 [+], 297 | Putative conjugal transfer protein | ||
13 | ORFL | 11962..12423 [+], 462 | Putative conjugal transfer protein | ||
14 | ORFK | 12437..14125 [+], 1689 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
15 | ORFJ | 14355..15596 [+], 1242 | Putative relaxase | Relaxase, MOBT Family | |
16 | ORFI | 15611..15841 [+], 231 | Putative conjugal transfer protein | ||
17 | ORFH | 15845..16402 [+], 558 | Putative conjugal transfer protein | ||
18 | ORFG | 16414..17409 [+], 996 | Putative conjugal transfer protein | ||
19 | ORFF | 17419..17643 [+], 225 | Putative conjugal transfer protein | ||
20 | ORFE | 17646..18056 [+], 411 | Putative conjugal transfer protein | YddD, T4SS component | |
21 | ORFD | 18070..20574 [+], 2505 | Putative conjugal transfer protein | YddE, T4SS component | |
22 | ORFC | 20586..22466 [+], 1881 | Putative conjugal transfer protein | YddG, T4SS component | |
23 | ORFB | 22468..22692 [+], 225 | Putative conjugal transfer protein | ||
24 | ORFA | 22709..23821 [+], 1113 | Putative conjugal transfer protein | Orf13_p, T4SS component | |
25 | - | 23880..24506 [+], 627 | hypothetical protein | ||
26 | xis | 24730..24978 [+], 249 | Excisionase | ||
27 | int | 24978..26324 [+], 1347 | Tyrosine integrase | Integrase |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] ![]() ![]() |
![]() |
![]() |