![]() | 741 |
![]() ![]() | ICE_SsaB35_rpsI ![]() |
![]() | Streptococcus salivarius B35 |
![]() | 28,407 |
![]() | 36.05 |
![]() | rpsI |
![]() | - |
![]() | - |
![]() | LT622825 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..28407 |
![]() ![]() | coordinates: 16660..16872; oriTDB id: 200003 GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT TTCTAATAGGGGGGTTACATTTGGCAAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA TTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATCAAAAGGAGGTGTTCCCA TGA |
![]() ![]() | coordinates: 16873..18105; Gene: ORFJ; Family: MOBT |
The graph information of ICE_SsaB35_rpsI components from LT622825 | |||||
![]() | |||||
Complete gene list of ICE_SsaB35_rpsI from LT622825 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 178..1086 [-], 909 | hypothetical protein | ||
2 | - | 1250..1549 [+], 300 | hypothetical protein | ||
3 | mcrC | 1878..3167 [-], 1290 | McrBC system restriction component | ||
4 | mcrB | 3164..4894 [-], 1731 | ATPase associated with various cellular activities | ||
5 | llaJIM2 | 4909..6042 [-], 1134 | Cytosine-specific methyltransferase | ||
6 | llaJIM1 | 6032..7435 [-], 1404 | Cytosine-specific methyltransferase | ||
7 | - | 7521..8381 [-], 861 | hypothetical protein | ||
8 | - | 8416..8709 [-], 294 | hypothetical protein | ||
9 | umuD | 8702..9064 [-], 363 | Uncharacterized protein | ||
10 | umuC | 9061..10476 [-], 1416 | SOS responce UmuC protein | ||
11 | arp1 | 10480..11160 [-], 681 | putative transcriptional regulator Arp1 | ||
12 | - | 11373..11732 [+], 360 | hypothetical protein | ||
13 | - | 11768..12976 [-], 1209 | hypothetical protein | ||
14 | arp2 | 12976..13314 [-], 339 | putative transcriptional regulator Arp2 | ||
15 | ORFO | 13902..13931 [+], 30 | Conserved protein of unknown function | ||
16 | ORFN | 13966..14148 [+], 183 | Conserved protein of unknown function | ||
17 | ORFM | 14187..14483 [+], 297 | putative conjugal transfer protein | ||
18 | ORFL | 14505..14966 [+], 462 | putative conjugal transfer protein | ||
19 | ORFK | 14980..16665 [+], 1686 | FtsK/SpoIIIE family coupling protein | YdcQ, T4SS component | |
20 | ORFJ | 16873..18105 [+], 1233 | putative relaxase | Relaxase, MOBT Family | |
21 | ORFI | 18120..18350 [+], 231 | putative conjugal transfer protein | ||
22 | ORFH | 18355..18912 [+], 558 | putative conjugal transfer protein | ||
23 | ORFG | 18924..19919 [+], 996 | putative conjugal transfer protein | ||
24 | ORFF | 19929..20153 [+], 225 | putative conjugal transfer protein | ||
25 | ORFE | 20156..20566 [+], 411 | putative conjugal transfer protein | YddD, T4SS component | |
26 | ORFD | 20580..23084 [+], 2505 | putative conjugal transfer protein | YddE, T4SS component | |
27 | ORFC | 23096..24976 [+], 1881 | putative conjugal transfer protein | YddG, T4SS component | |
28 | ORFB | 24978..25202 [+], 225 | putative conjugal transfer protein | ||
29 | ORFA | 25219..26331 [+], 1113 | putative conjugal transfer protein | Orf13_p, T4SS component | |
30 | - | 26397..26672 [+], 276 | hypothetical protein | ||
31 | xis | 26798..27070 [+], 273 | excisionase | ||
32 | int | 27081..28295 [+], 1215 | tyrosine integrase | Integrase |
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PubMed:28432093] ![]() ![]() |
![]() |
![]() |