ICEberg
I. Information of ICE
ICEberg ID70
Name ICEEc1 This ICE is derived from experimental literature
ICEO ID ICEO_0000142
OrganismEscherichia coli ECOR31
Size (bp)38927
GC content [Genome] (%)47.73
Insertion sitetRNA-Asn
FunctionPathogenicity
Species that ICE can be transferred toEscherichia coli
Nucleotide SequenceAY233333 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..38927 
Putative oriT region coordinates: 17702..17825;   oriTDB id:  200012
CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC
TAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEEc1 is not available.



The graph information of ICEEc1 components from AY233333
Complete gene list of ICEEc1 from AY233333
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1fyuA1..2022 [+], 2022FyuAVF 
2-6054..6338 [-], 285unknown
3-6362..7072 [+], 711Pilx1/VirB1-like proteinVirB1, T4SS component 
4-7072..7365 [+], 294VirB2-like proteinVirB2, T4SS component 
5-7378..10116 [+], 2739Pilx3-4/VirB3-4-like proteinVirB4, T4SS component 
6-10134..10841 [+], 708Pilx5/VirB5-like proteinVirB5, T4SS component 
7-10849..11091 [+], 243unknownMagB05, T4SS component 
8-11095..12168 [+], 1074Pilx6/VirB6-like proteinVirB6, T4SS component 
9-12260..12397 [+], 138unknownVirB7, T4SS component 
10-12390..13073 [+], 684PilX8-VirB8-like proteinVirB8, T4SS component 
11-13070..13978 [+], 909Pilx9/VirB9-like proteinVirB9, T4SS component 
12-14022..15272 [+], 1251Pilx10/VirB10-like proteinVirB10, T4SS component 
13-15262..16287 [+], 1026Pilx11/VirB11-like proteinVirB11, T4SS component 
14-16717..17022 [+], 306YggA-like protein
15-17056..17361 [+], 306unknown
16-17472..17774 [+], 303unknown
17-18041..19930 [+], 1890MobB-like proteinVirD4, T4SS component 
18-19940..20686 [+], 747MobC-like protein
19-20747..23641 [-], 2895helicase-like protein
20-24254..25033 [-], 780VrlR-like protein
21-25337..26284 [-], 948antirestriction protein
22-26817..27848 [+], 1032TnpA-like proteinIntegrase 
23-28380..28640 [+], 261unknown
24-28650..29252 [+], 603unknown
25-29598..30134 [-], 537VC0181-like protein
26-30198..31814 [-], 1617VC0180-like protein
27-31814..33112 [-], 1299VC0179-like protein
28-33112..34197 [-], 1086VC0178-like protein
29-34606..36324 [-], 1719unknown
30-36412..37305 [-], 894unknown
31-37401..38282 [-], 882patatin-like protein
32-38778..39002 [+], 225unknown
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins31Fasta
(1) Schubert S; Dufke S; Sorsa J; Heesemann J (2004). A novel integrative and conjugative element (ICE) of Escherichia coli: the putative progenitor of the Yersinia high-pathogenicity island. Mol Microbiol. 51(3):837-48. [PubMed:14731283] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU