ICEberg
I. Information of ICE
ICEberg ID62
Name CTn6002 This ICE is derived from experimental literature
ICEO ID ICEO_0000359
OrganismStreptococcus cristatus
Size (bp)20880
GC content [Genome] (%)38.23
Insertion site-
FunctionErythromycin resistance
Species that ICE can be transferred toStreptococcus cristatus; Streptococcus sanguinis
Nucleotide SequenceAY898750 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..20880 
Putative oriT region coordinates: 2501..2633;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2860..4062;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of CTn6002 is not available.



The graph information of CTn6002 components from AY898750
Complete gene list of CTn6002 from AY898750
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-194..313 [+], 120hypothetical protein
2-336..650 [+], 315hypothetical protein
3-666..1052 [+], 387hypothetical protein
4-1081..2466 [+], 1386hypothetical proteinOrf21_Tn, T4SS component 
5-2860..4062 [+], 1203hypothetical proteinRelaxase, MOBT Family
6-3895..4062 [+], 168MLS leader peptide
7-4111..4194 [+], 84MLS leader peptide
8-4319..5056 [+], 738MLS methylaseAR 
9-5001..5192 [+], 192hypothetical protein
10-5313..6560 [-], 1248hypothetical protein
11-6740..6961 [+], 222hypothetical proteinOrf19_Tn, T4SS component 
12-7078..7575 [+], 498hypothetical protein
13-7550..8056 [+], 507hypothetical proteinOrf17_Tn, T4SS component 
14-8040..10487 [+], 2448hypothetical proteinOrf16_Tn, T4SS component 
15-10490..12667 [+], 2178hypothetical proteinOrf15_Tn, T4SS component 
16-12664..13449 [+], 786hypothetical proteinOrf14_Tn, T4SS component 
17-13662..14594 [+], 933hypothetical proteinOrf13_Tn, T4SS component 
18-14869..14955 [+], 87hypothetical protein
19-14971..16890 [+], 1920tetracycline resistance protein TetMAR 
20-16988..17176 [+], 189hypothetical protein
21-17236..17589 [-], 354hypothetical protein
22-17794..17865 [+], 72hypothetical protein
23-18043..18516 [+], 474hypothetical protein
24-18513..18743 [+], 231hypothetical protein
25-18969..19220 [-], 252hypothetical protein
26-19204..19407 [+], 204Xis-Tn
27-19489..20706 [+], 1218Int-TnIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins27Fasta
(1) Warburton PJ; Palmer RM; Munson MA; Wade WG (2007). Demonstration of in vivo transfer of doxycycline resistance mediated by a novel transposon. J Antimicrob Chemother. 60(5):973-80. [PubMed:17855723] experimental
 
experimental experimental literature