![]() | 47 |
![]() ![]() | Tn5251 (part of Tn5253) ![]() |
![]() ![]() | ICEO_0000357 |
![]() | Streptococcus pneumoniae DP1322 |
![]() | 18033 |
![]() | 38.85 |
![]() | AT rich regions |
![]() | Tetracycline resistance |
![]() | Streptococcus pneumoniae; Streptococcus gordonii; Streptococcus pyogenes; Streptococcus agalactiae;Enterococcus faecalis; Bacillus subtilis |
![]() | FJ711160 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..18033 |
![]() ![]() | coordinates: 15400..15532; oriTDB id: 200001 GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT |
![]() ![]() | coordinates: 14184..15389; Family: MOBT |
The graph information of Tn5251 (part of Tn5253) components from FJ711160 | |||||
![]() | |||||
Complete gene list of Tn5251 (part of Tn5253) from FJ711160 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 175..1392 [-], 1218 | integrase | Integrase | |
2 | - | 1474..1677 [-], 204 | excisionase | ||
3 | - | 1661..1912 [+], 252 | unknown | ||
4 | - | 2138..2368 [-], 231 | unknown | ||
5 | - | 2365..2787 [-], 423 | putative sigma factor | ||
6 | - | 3016..3162 [-], 147 | unknown | ||
7 | - | 3292..3645 [+], 354 | putative transcriptional regulator | ||
8 | - | 3705..3893 [-], 189 | unknown | ||
9 | - | 3991..5910 [-], 1920 | tetracycline resistance protein | AR | |
10 | - | 5926..6012 [-], 87 | tet(M) leader peptide | ||
11 | - | 6287..7219 [-], 933 | unknown | Orf13_Tn, T4SS component | |
12 | - | 7216..8217 [-], 1002 | putative cell wall hydrolase | Orf14_Tn, T4SS component | |
13 | - | 8214..10391 [-], 2178 | unknown | Orf15_Tn, T4SS component | |
14 | - | 10394..12841 [-], 2448 | type IV secretion protein virB4 | Orf16_Tn, T4SS component | |
15 | - | 12825..13331 [-], 507 | unknown | Orf17_Tn, T4SS component | |
16 | - | 13306..13803 [-], 498 | antirestriction protein | ||
17 | - | 13920..14141 [-], 222 | unknown | Orf19_Tn, T4SS component | |
18 | - | 14184..15389 [-], 1206 | relaxase | Relaxase, MOBT Family | |
19 | - | 15567..16952 [-], 1386 | FtsK-SpoIIIE family protein | Orf21_Tn, T4SS component | |
20 | - | 16981..17364 [-], 384 | unknown | ||
21 | - | 17383..17697 [-], 315 | unknown | ||
22 | - | 17720..17839 [-], 120 | unknown |
(1) Santoro F; Oggioni MR; Pozzi G; Iannelli F (2010). Nucleotide sequence and functional analysis of the tet (M)-carrying conjugative transposon Tn5251 of Streptococcus pneumoniae. FEMS Microbiol Lett. 308(2):150-8. [PubMed:20487027] ![]() |
(2) Provvedi R; Manganelli R; Pozzi G (1996). Characterization of conjugative transposon Tn5251 of Streptococcus pneumoniae. FEMS Microbiol Lett. 135(2-3):231-6. [PubMed:8595862] ![]() |
(3) Ayoubi P; Kilic AO; Vijayakumar MN (1991). Tn5253, the pneumococcal omega (cat tet) BM6001 element, is a composite structure of two conjugative transposons, Tn5251 and Tn5252. J Bacteriol. 173(5):1617-22. [PubMed:1847905] ![]() |
![]() |