I. Information of ICE

ICEberg ID	47
Name	Tn5251 (part of Tn5253)
ICEO ID	ICEO_0000357
Organism	Streptococcus pneumoniae DP1322
Size (bp)	18033
GC content [Genome] (%)	38.85
Insertion site	AT rich regions
Function	Tetracycline resistance
Species that ICE can be transferred to	Streptococcus pneumoniae; Streptococcus gordonii; Streptococcus pyogenes; Streptococcus agalactiae;Enterococcus faecalis; Bacillus subtilis
Nucleotide Sequence	FJ711160 (complete ICE sequence in this GenBank file)
Replicon	-
Coordinates	1..18033
Putative oriT region	coordinates: 15400..15532;   oriTDB id:  200001 GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase	coordinates: 14184..15389;   Family:  MOBT

II. ICE interaction with IME/CIME/

The interaction information of Tn5251 (part of Tn5253) is not available.

The graph information of Tn5251 (part of Tn5253) components from FJ711160
Complete gene list of Tn5251 (part of Tn5253) from FJ711160
#	Gene	Coordinates [+/-], size (bp)	Product  (GenBank annotation)	*Reannotation
1	-	175..1392 [-], 1218	integrase	Integrase
2	-	1474..1677 [-], 204	excisionase
3	-	1661..1912 [+], 252	unknown
4	-	2138..2368 [-], 231	unknown
5	-	2365..2787 [-], 423	putative sigma factor
6	-	3016..3162 [-], 147	unknown
7	-	3292..3645 [+], 354	putative transcriptional regulator
8	-	3705..3893 [-], 189	unknown
9	-	3991..5910 [-], 1920	tetracycline resistance protein	AR
10	-	5926..6012 [-], 87	tet(M) leader peptide
11	-	6287..7219 [-], 933	unknown	Orf13_Tn, T4SS component
12	-	7216..8217 [-], 1002	putative cell wall hydrolase	Orf14_Tn, T4SS component
13	-	8214..10391 [-], 2178	unknown	Orf15_Tn, T4SS component
14	-	10394..12841 [-], 2448	type IV secretion protein virB4	Orf16_Tn, T4SS component
15	-	12825..13331 [-], 507	unknown	Orf17_Tn, T4SS component
16	-	13306..13803 [-], 498	antirestriction protein
17	-	13920..14141 [-], 222	unknown	Orf19_Tn, T4SS component
18	-	14184..15389 [-], 1206	relaxase	Relaxase, MOBT Family
19	-	15567..16952 [-], 1386	FtsK-SpoIIIE family protein	Orf21_Tn, T4SS component
20	-	16981..17364 [-], 384	unknown
21	-	17383..17697 [-], 315	unknown
22	-	17720..17839 [-], 120	unknown

(1) Santoro F; Oggioni MR; Pozzi G; Iannelli F (2010). Nucleotide sequence and functional analysis of the tet (M)-carrying conjugative transposon Tn5251 of Streptococcus pneumoniae. FEMS Microbiol Lett. 308(2):150-8. [PubMed:20487027]

(2) Provvedi R; Manganelli R; Pozzi G (1996). Characterization of conjugative transposon Tn5251 of Streptococcus pneumoniae. FEMS Microbiol Lett. 135(2-3):231-6. [PubMed:8595862]

(3) Ayoubi P; Kilic AO; Vijayakumar MN (1991). Tn5253, the pneumococcal omega (cat tet) BM6001 element, is a composite structure of two conjugative transposons, Tn5251 and Tn5252. J Bacteriol. 173(5):1617-22. [PubMed:1847905]

experimental literature