 ICEberg ID | 43 |
Name  | R391  |
| ICEO ID | ICEO_0000016 |
| Organism | Providencia rettgeri |
| Size (bp) | 88532 |
| GC content [Genome] (%) | 46.48 |
| Insertion site | prfC |
| Function | Kanamycin and mercury resistance |
| Species that ICE can be transferred to | Escherichia coli; Bacteroides spp. |
| Nucleotide Sequence | AY090559 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..88532 |
| Putative oriT region | coordinates: 5604..5710; oriTDB id: 200057 TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTAGTTTTGGTTTTTGGGGTTAATTGGATGGGGAA |
| Putative relaxase | coordinates: 32341..34491; Family: MOBH |
The graph information of R391 components from AY090559 | |||||
 | |||||
| Complete gene list of R391 from AY090559 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 119..442 [-], 324 | hypothetical protein | ||
| 2 | - | 790..1110 [+], 321 | hypothetical protein | ||
| 3 | - | 1103..2317 [+], 1215 | hypothetical protein | ||
| 4 | - | 2528..2728 [+], 201 | hypothetical protein | ||
| 5 | - | 2745..3986 [-], 1242 | Int | Integrase | |
| 6 | - | 3988..4257 [-], 270 | hypothetical protein | ||
| 7 | - | 4260..5234 [-], 975 | hypothetical protein | ||
| 8 | - | 5339..5545 [-], 207 | hypothetical protein | ||
| 9 | - | 5944..6114 [-], 171 | hypothetical protein | ||
| 10 | - | 6153..7460 [-], 1308 | RumB | mutagenic DNA repair; [PMID: 7751283; 12193633] | |
| 11 | - | 7429..7878 [-], 450 | RumA | mutagenic DNA repair; [PMID: 7751283; 12193633] | |
| 12 | - | 8406..8723 [-], 318 | hypothetical protein | ORF13; a putative exonuclease involved in UV sensitization; [PMID: 12193633] | |
| 13 | - | 8518..9426 [+], 909 | hypothetical protein | ||
| 14 | - | 9500..9814 [+], 315 | hypothetical protein | ||
| 15 | - | 9883..10809 [+], 927 | hypothetical protein | ||
| 16 | - | 10919..11635 [-], 717 | transposase tnpIS15 | [PMID: 12193633] | |
| 17 | - | 11096..11935 [+], 840 | hypothetical protein | ||
| 18 | - | 11952..12560 [-], 609 | hypothetical protein | ||
| 19 | - | 12021..12737 [+], 717 | transposase tnpIS15 | [PMID: 12193633] | |
| 20 | - | 12877..13692 [+], 816 | aminoglycoside phospotransferase Aph | AR | |
| 21 | - | 13872..14588 [-], 717 | transposase tnpIS15 | [PMID: 12193633] | |
| 22 | - | 14049..14648 [+], 600 | hypothetical protein | ||
| 23 | - | 14567..15199 [+], 633 | hypothetical protein | TraU_I, T4SS component | |
| 24 | - | 15196..15780 [+], 585 | hypothetical protein | ||
| 25 | - | 15799..18642 [+], 2844 | putative ATPase | ||
| 26 | - | 18524..19477 [+], 954 | hypothetical protein | ||
| 27 | - | 19634..20149 [+], 516 | hypothetical protein | ||
| 28 | - | 20708..21385 [+], 678 | putative transposase tnp391A | [PMID: 12193633] | |
| 29 | - | 21303..24554 [+], 3252 | hypothetical protein | ||
| 30 | - | 24554..27238 [+], 2685 | hypothetical protein | ||
| 31 | - | 27251..29491 [+], 2241 | putative ATP-dependent Lon protease | ||
| 32 | - | 29535..32186 [+], 2652 | hypothetical protein | ||
| 33 | - | 32341..34491 [+], 2151 | TraI | Relaxase, MOBH Family | |
| 34 | - | 34540..36360 [+], 1821 | TraD | TraD_F, T4SS component | |
| 35 | - | 36370..36930 [+], 561 | hypothetical protein | ||
| 36 | - | 36908..37552 [+], 645 | hypothetical protein | ||
| 37 | - | 37579..38166 [-], 588 | hypothetical protein | ||
| 38 | - | 38180..38419 [-], 240 | hypothetical protein | ||
| 39 | - | 38455..38736 [+], 282 | TraL | TraL_F, T4SS component | |
| 40 | - | 38967..39359 [+], 393 | TraE | TraE_F, T4SS component | |
| 41 | - | 39340..40242 [+], 903 | TraK | TraK_F, T4SS component | |
| 42 | - | 40242..41531 [+], 1290 | TraB | TraB_F, T4SS component | |
| 43 | - | 41528..42178 [+], 651 | HtdD | TraV_F, T4SS component | |
| 44 | - | 42175..42561 [+], 387 | TraA | TraA_F, T4SS component | |
| 45 | - | 42602..42922 [-], 321 | unknown | ||
| 46 | - | 43099..43365 [-], 267 | unknown | ||
| 47 | - | 43543..43920 [-], 378 | hypothetical protein | ||
| 48 | - | 44406..45323 [+], 918 | putative transposase tnpR391B | a putative transposase; [PMID: 12193633] | |
| 49 | - | 45687..46010 [-], 324 | hypothetical protein | ||
| 50 | - | 45742..47268 [+], 1527 | putative sulfate permease | ||
| 51 | - | 46452..46700 [-], 249 | hypothetical protein | ||
| 52 | - | 47280..48131 [+], 852 | hypothetical protein | ||
| 53 | - | 48155..48604 [-], 450 | hypothetical protein | ||
| 54 | - | 48635..49144 [-], 510 | hypothetical protein | ||
| 55 | - | 49249..49425 [-], 177 | hypothetical protein | ||
| 56 | - | 49588..50280 [+], 693 | DsbC | TrbB_I, T4SS component | |
| 57 | - | 50280..52679 [+], 2400 | TraC | TraC_F, T4SS component | |
| 58 | - | 53024..53515 [+], 492 | TrhF | TraF, T4SS component | |
| 59 | - | 53523..54650 [+], 1128 | TraW | TraW_F, T4SS component | |
| 60 | - | 54634..55662 [+], 1029 | TraU | TraU_F, T4SS component | |
| 61 | - | 55665..59357 [+], 3693 | TraN | TraN_F, T4SS component | |
| 62 | - | 59951..60613 [+], 663 | hypothetical protein | ||
| 63 | - | 60704..61306 [-], 603 | hypothetical protein | ||
| 64 | - | 61662..62000 [+], 339 | hypothetical protein | ||
| 65 | - | 62016..62435 [+], 420 | hypothetical protein | ||
| 66 | - | 62515..63333 [+], 819 | hypothetical protein | ||
| 67 | - | 63621..64637 [+], 1017 | hypothetical protein | ||
| 68 | - | 64730..65806 [+], 1077 | hypothetical protein | ||
| 69 | - | 65806..66573 [+], 768 | hypothetical protein | ||
| 70 | - | 66672..67625 [+], 954 | hypothetical protein | ||
| 71 | - | 67687..68127 [+], 441 | unknown | ||
| 72 | - | 68197..69852 [+], 1656 | hypothetical protein | ||
| 73 | - | 69938..70435 [+], 498 | hypothetical protein | ||
| 74 | - | 70435..70776 [+], 342 | hypothetical protein | ||
| 75 | - | 70439..70750 [+], 312 | hypothetical protein | ||
| 76 | - | 70867..71940 [+], 1074 | hypothetical protein | ||
| 77 | - | 72030..72737 [+], 708 | hypothetical protein | ||
| 78 | - | 73088..73630 [+], 543 | hypothetical protein | ||
| 79 | - | 74368..75312 [+], 945 | TraF | TraF_F, T4SS component | |
| 80 | - | 75315..76703 [+], 1389 | TraH | TraH_F, T4SS component | |
| 81 | - | 76707..80276 [+], 3570 | TraG | TraG_F, T4SS component | |
| 82 | - | 80374..80763 [+], 390 | MerR | regulatory gene of mercury resistance operon; [PMID: 12193633] | |
| 83 | - | 80848..81171 [+], 324 | MerT | structural gene of mercury resistance operon; [PMID: 12193633] | |
| 84 | - | 81256..81531 [+], 276 | MerP | structural gene of mercury resistance operon; [PMID: 12193633] | |
| 85 | - | 81541..81954 [+], 414 | MerC | structural gene of mercury resistance operon; [PMID: 12193633] | |
| 86 | - | 81992..83665 [+], 1674 | MerA | structural gene of mercury resistance operon; [PMID: 12193633] | |
| 87 | - | 83771..84202 [-], 432 | hypothetical protein | ||
| 88 | - | 84257..84790 [-], 534 | hypothetical protein | ||
| 89 | - | 84787..85086 [-], 300 | hypothetical protein | ||
| 90 | - | 85083..85631 [-], 549 | hypothetical protein | Orf169_F, T4SS component | |
| 91 | - | 85618..86226 [-], 609 | hypothetical protein | ||
| 92 | - | 86267..87136 [-], 870 | hypothetical protein | ||
| 93 | - | 87286..87495 [+], 210 | hypothetical protein | ||
| 94 | - | 87561..88208 [+], 648 | putative transcriptional regulator | ||
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PubMed:20041216] 
|
|
(2) Garriss G; Waldor MK; Burrus V (2009). Mobile antibiotic resistance encoding elements promote their own diversity. PLoS Genet. 5(12):e1000775. [PubMed:20019796]
|
|
(3) Bordeleau E; Brouillette E; Robichaud N; Burrus V (2010). Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 12(2):510-23. [PubMed:19888998]
|
|
(4) Ceccarelli D; Daccord A; Rene M; Burrus V (2008). Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PubMed:18539733]
|
|
(5) Taviani E; Ceccarelli D; Lazaro N; Bani S; Cappuccinelli P; Colwell RR; Colombo MM (2008). Environmental Vibrio spp., isolated in Mozambique, contain a polymorphic group of integrative conjugative elements and class 1 integrons. FEMS Microbiol Ecol. 64(1):45-54. [PubMed:18318712]
|
|
(6) Marrero J; Waldor MK (2007). Determinants of entry exclusion within Eex and TraG are cytoplasmic. J Bacteriol. 189(17):6469-73. [PubMed:17573467]
|
|
(7) O'Halloran JA; McGrath BM; Pembroke JT (2007). The orf4 gene of the enterobacterial ICE, R391, encodes a novel UV-inducible recombination directionality factor, Jef, involved in excision and transfer of the ICE. FEMS Microbiol Lett. 272(1):99-105. [PubMed:17504243]
|
|
(8) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PubMed:17307849]
|
|
(9) Mead S; Vaisman A; Valjavec-Gratian M; Karata K; Vandewiele D; Woodgate R (2007). Characterization of polVR391: a Y-family polymerase encoded by rumA'B from the IncJ conjugative transposon, R391. Mol Microbiol. 63(3):797-810. [PubMed:17302804]
|
|
(10) Marrero J; Waldor MK (2005). Interactions between inner membrane proteins in donor and recipient cells limit conjugal DNA transfer. Dev Cell. 8(6):963-70. [PubMed:15935784]
|
|
(11) McGrath BM; O'Halloran JA; Pembroke JT (2005). Pre-exposure to UV irradiation increases the transfer frequency of the IncJ conjugative transposon-like elements R391, R392, R705, R706, R997 and pMERPH and is recA+ dependent. FEMS Microbiol Lett. 243(2):461-5. [PubMed:15686850]
|
|
(12) McGrath BM; Pembroke JT (2004). Detailed analysis of the insertion site of the mobile elements R997, pMERPH, R392, R705 and R391 in E. coli K12. FEMS Microbiol Lett. 237(1):19-26. [PubMed:15268933]
|
|
(13) Sabater-Munoz B; van Ham RC; Moya A; Silva FJ; Latorre A (2004). Evolution of the leucine gene cluster in Buchnera aphidicola: insights from chromosomal versions of the cluster. J Bacteriol. 186(9):2646-54. [PubMed:15090505]
|
|
(14) Boltner D; Osborn AM (2004). Structural comparison of the integrative and conjugative elements R391, pMERPH, R997, and SXT. Plasmid. 51(1):12-23. [PubMed:14711525]
|
|
(15) Boltner D; MacMahon C; Pembroke JT; Strike P; Osborn AM (2002). R391: a conjugative integrating mosaic comprised of phage, plasmid, and transposon elements. J Bacteriol. 184(18):5158-69. [PubMed:12193633]
|
|
(16) Hochhut B; Beaber JW; Woodgate R; Waldor MK (2001). Formation of chromosomal tandem arrays of the SXT element and R391, two conjugative chromosomally integrating elements that share an attachment site. J Bacteriol. 183(4):1124-32. [PubMed:11157923]
|
|
(17) Murphy DB; Pembroke JT (1999). Monitoring of chromosomal insertions of the IncJ elements R391 and R997 in Escherichia coli K-12. FEMS Microbiol Lett. 174(2):355-61. [PubMed:10339829]
|
|
(18) Murphy DB; Pembroke JT (1995). Transfer of the IncJ plasmid R391 to recombination deficient Escherichia coli K12: evidence that R391 behaves as a conjugal transposon. FEMS Microbiol Lett. 134(2-3):153-8. [PubMed:8586262]
|
|
(19) Peters SE; Hobman JL; Strike P; Ritchie DA (1991). Novel mercury resistance determinants carried by IncJ plasmids pMERPH and R391. Mol Gen Genet. 228(1-2):294-9. [PubMed:1886614]
|
| experimental literature |
| in silico analysis literature |