 ICEberg ID | 38 |
Name  | ICEPdaSpa1  |
| ICEO ID | ICEO_0000015 |
| Organism | Photobacterium damselae subsp. piscicida PC554.2 |
| Size (bp) | 102985 |
| GC content [Genome] (%) | 46.34 |
| Insertion site | prfC |
| Function | Antibiotic resistance genes: tetAR |
| Species that ICE can be transferred to | Escherichia coli |
| Nucleotide Sequence | AJ870986 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..102985 |
| Putative oriT region | coordinates: 3696..3802; oriTDB id: 200056 TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA |
| Putative relaxase | coordinates: 39300..41450; Gene: traI; Family: MOBH |
The graph information of ICEPdaSpa1 components from AJ870986 | |||||
 | |||||
| Complete gene list of ICEPdaSpa1 from AJ870986 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | xis | 620..820 [+], 201 | Xis | ||
| 2 | int | 837..2078 [-], 1242 | Int | ||
| 3 | s002 | 2080..2349 [-], 270 | S002 | ||
| 4 | s003 | 2352..3326 [-], 975 | S003 | ||
| 5 | rumB | 4245..5417 [-], 1173 | - | ||
| 6 | tnp | 5701..6294 [+], 594 | Tnp | ||
| 7 | tnpA | 6408..9386 [+], 2979 | TnpA | ||
| 8 | tnpB | 9804..11297 [+], 1494 | TnpB | ||
| 9 | s013 | 11328..11612 [+], 285 | - | ||
| 10 | tetA | 11676..12878 [-], 1203 | TetA | AR | |
| 11 | tetR | 12959..13561 [+], 603 | TetR | ||
| 12 | tnpB | 13740..13892 [+], 153 | - | ||
| 13 | tnpI | 13951..14241 [+], 291 | TnpI | ||
| 14 | tnpII | 14373..15104 [+], 732 | TnpII | Integrase | |
| 15 | s021 | 15115..16092 [-], 978 | hypothetical protein | ||
| 16 | rumB | 16299..16607 [-], 309 | - | ||
| 17 | rumA | 16576..17025 [-], 450 | RumA | ||
| 18 | s024 | 17665..18573 [+], 909 | hypothetical protein | ||
| 19 | s025 | 18647..18961 [+], 315 | hypothetical protein | ||
| 20 | s026 | 19030..19956 [+], 927 | hypothetical protein | ||
| 21 | s027 | 19966..20565 [+], 600 | hypothetical protein | ||
| 22 | s028 | 20562..21146 [+], 585 | hypothetical protein | ||
| 23 | s029 | 21165..24842 [+], 3678 | hypothetical protein | ||
| 24 | s031 | 24853..26022 [+], 1170 | hypothetical protein | ||
| 25 | s033 | 26030..26779 [+], 750 | hypothetical protein | ||
| 26 | s035 | 26776..28209 [+], 1434 | hypothetical protein | ||
| 27 | is10 | 28188..29396 [-], 1209 | IS10 | ||
| 28 | s035 | 29995..31701 [+], 1707 | - | ||
| 29 | s038 | 31701..34358 [+], 2658 | hypothetical protein | ||
| 30 | s039 | 34375..36450 [+], 2076 | hypothetical protein | ||
| 31 | s040 | 36494..39145 [+], 2652 | hypothetical protein | ||
| 32 | traI | 39300..41450 [+], 2151 | TraI | Relaxase, MOBH Family | |
| 33 | traD | 41498..43318 [+], 1821 | TraD | TraD_F, T4SS component | |
| 34 | s043 | 43875..44510 [+], 636 | hypothetical protein | ||
| 35 | orf37 | 44537..45124 [-], 588 | hypothetical protein | ||
| 36 | orf38 | 45138..45377 [-], 240 | hypothetical protein | ||
| 37 | traL | 45413..45694 [+], 282 | TraL | TraL_F, T4SS component | |
| 38 | traE | 45691..46317 [+], 627 | TraE | TraE_F, T4SS component | |
| 39 | s048 | 46298..47197 [+], 900 | hypothetical protein | TraK_F, T4SS component | |
| 40 | traB | 47200..48489 [+], 1290 | TraB | TraB_F, T4SS component | |
| 41 | traV | 48486..49136 [+], 651 | TraV | TraV_F, T4SS component | |
| 42 | traA | 49133..49519 [+], 387 | TraA | TraA_F, T4SS component | |
| 43 | s052 | 49697..50530 [+], 834 | hypothetical protein | ||
| 44 | s053 | 50523..51461 [+], 939 | hypothetical protein | ||
| 45 | spa01 | 52041..54770 [+], 2730 | hypothetical protein | ||
| 46 | spa02 | 54767..55876 [+], 1110 | hypothetical protein | ||
| 47 | spa03 | 55889..57421 [+], 1533 | hypothetical protein | ||
| 48 | spa04 | 57736..58869 [+], 1134 | hypothetical protein | ||
| 49 | s054 | 59015..59707 [+], 693 | hypothetical protein | TrbB_I, T4SS component | |
| 50 | traC | 59707..62106 [+], 2400 | TraC | TraC_F, T4SS component | |
| 51 | trsF | 62430..62942 [+], 513 | TrsF | TraF, T4SS component | |
| 52 | traW | 62893..64077 [+], 1185 | TraW | TraW_F, T4SS component | |
| 53 | traU | 64061..65089 [+], 1029 | TraU | TraU_F, T4SS component | |
| 54 | traN | 65092..68784 [+], 3693 | TraN | TraN_F, T4SS component | |
| 55 | spa05 | 68947..69474 [-], 528 | hypothetical protein | ||
| 56 | spa06 | 69484..70257 [-], 774 | hypothetical protein | ||
| 57 | s063 | 70416..71018 [-], 603 | hypothetical protein | ||
| 58 | s089 | 71386..71712 [+], 327 | hypothetical protein | ||
| 59 | ssb | 71728..72147 [+], 420 | hypothetical protein | ||
| 60 | s065 | 72227..73045 [+], 819 | hypothetical protein | ||
| 61 | s066 | 73333..74349 [+], 1017 | hypothetical protein | ||
| 62 | s067 | 74442..75518 [+], 1077 | hypothetical protein | ||
| 63 | s088 | 75518..76285 [+], 768 | hypothetical protein | ||
| 64 | s068 | 76384..77337 [+], 954 | hypothetical protein | ||
| 65 | s069 | 77399..77839 [+], 441 | hypothetical protein | ||
| 66 | s070 | 77909..79564 [+], 1656 | hypothetical protein | ||
| 67 | s071 | 79648..80145 [+], 498 | hypothetical protein | ||
| 68 | s072 | 80577..81644 [+], 1068 | hypothetical protein | ||
| 69 | IS10 | 81904..83112 [-], 1209 | IS10 | ||
| 70 | spa07 | 83835..86330 [+], 2496 | hypothetical protein | ||
| 71 | spa08 | 86334..87803 [+], 1470 | hypothetical protein | ||
| 72 | spa09 | 87816..89477 [+], 1662 | hypothetical protein | ||
| 73 | spa10 | 89470..90177 [+], 708 | hypothetical protein | ||
| 74 | spa11 | 90286..91680 [+], 1395 | hypothetical protein | ||
| 75 | vrlR | 91687..92181 [+], 495 | - | ||
| 76 | traF | 92280..93224 [+], 945 | TraF | TraF_F, T4SS component | |
| 77 | traH | 93227..94615 [+], 1389 | TraH | TraH_F, T4SS component | |
| 78 | traG | 94619..98188 [+], 3570 | TraG | TraG_F, T4SS component | |
| 79 | eex | 98221..98652 [-], 432 | Eex | ||
| 80 | setC | 98710..99243 [-], 534 | SetC | ||
| 81 | setD | 99240..99539 [-], 300 | SetD | ||
| 82 | s083 | 100071..100679 [-], 609 | hypothetical protein | ||
| 83 | s084 | 100720..101589 [-], 870 | hypothetical protein | ||
| 84 | setQ | 101645..101896 [-], 252 | SetQ | ||
| 85 | setR | 102014..102661 [+], 648 | SetR | ||
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PubMed:20041216] 
|
|
(2) Ceccarelli D; Daccord A; Rene M; Burrus V (2008). Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PubMed:18539733]
|
|
(3) Osorio CR; Marrero J; Wozniak RA; Lemos ML; Burrus V; Waldor MK (2008). Genomic and functional analysis of ICEPdaSpa1, a fish-pathogen-derived SXT-related integrating conjugative element that can mobilize a virulence plasmid. J Bacteriol. 190(9):3353-61. [PubMed:18326579]
|
|
(4) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PubMed:17307849]
|
|
(5) Juiz-Rio S; Osorio CR; de Lorenzo V; Lemos ML (2005). Subtractive hybridization reveals a high genetic diversity in the fish pathogen Photobacterium damselae subsp. piscicida: evidence of a SXT-like element. Microbiology. 151(Pt 8):2659-69. [PubMed:16079344]
|
| experimental literature |
| in silico analysis literature |