ICEberg
I. Information of ICE
ICEberg ID38
Name ICEPdaSpa1 This ICE is derived from experimental literature
ICEO ID ICEO_0000015
OrganismPhotobacterium damselae subsp. piscicida PC554.2
Size (bp)102985
GC content [Genome] (%)46.34
Insertion siteprfC
FunctionAntibiotic resistance genes: tetAR
Species that ICE can be transferred toEscherichia coli
Nucleotide SequenceAJ870986 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..102985 
Putative oriT region coordinates: 3696..3802;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 39300..41450; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPdaSpa1 is not available.



The graph information of ICEPdaSpa1 components from AJ870986
Complete gene list of ICEPdaSpa1 from AJ870986
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1xis620..820 [+], 201Xis
2int837..2078 [-], 1242Int
3s0022080..2349 [-], 270S002
4s0032352..3326 [-], 975S003
5rumB4245..5417 [-], 1173-
6tnp5701..6294 [+], 594Tnp
7tnpA6408..9386 [+], 2979TnpA
8tnpB9804..11297 [+], 1494TnpB
9s01311328..11612 [+], 285-
10tetA11676..12878 [-], 1203TetAAR 
11tetR12959..13561 [+], 603TetR
12tnpB13740..13892 [+], 153-
13tnpI13951..14241 [+], 291TnpI
14tnpII14373..15104 [+], 732TnpIIIntegrase 
15s02115115..16092 [-], 978hypothetical protein
16rumB16299..16607 [-], 309-
17rumA16576..17025 [-], 450RumA
18s02417665..18573 [+], 909hypothetical protein
19s02518647..18961 [+], 315hypothetical protein
20s02619030..19956 [+], 927hypothetical protein
21s02719966..20565 [+], 600hypothetical protein
22s02820562..21146 [+], 585hypothetical protein
23s02921165..24842 [+], 3678hypothetical protein
24s03124853..26022 [+], 1170hypothetical protein
25s03326030..26779 [+], 750hypothetical protein
26s03526776..28209 [+], 1434hypothetical protein
27is1028188..29396 [-], 1209IS10
28s03529995..31701 [+], 1707-
29s03831701..34358 [+], 2658hypothetical protein
30s03934375..36450 [+], 2076hypothetical protein
31s04036494..39145 [+], 2652hypothetical protein
32traI39300..41450 [+], 2151TraIRelaxase, MOBH Family
33traD41498..43318 [+], 1821TraDTraD_F, T4SS component 
34s04343875..44510 [+], 636hypothetical protein
35orf3744537..45124 [-], 588hypothetical protein
36orf3845138..45377 [-], 240hypothetical protein
37traL45413..45694 [+], 282TraLTraL_F, T4SS component 
38traE45691..46317 [+], 627TraETraE_F, T4SS component 
39s04846298..47197 [+], 900hypothetical proteinTraK_F, T4SS component 
40traB47200..48489 [+], 1290TraBTraB_F, T4SS component 
41traV48486..49136 [+], 651TraVTraV_F, T4SS component 
42traA49133..49519 [+], 387TraATraA_F, T4SS component 
43s05249697..50530 [+], 834hypothetical protein
44s05350523..51461 [+], 939hypothetical protein
45spa0152041..54770 [+], 2730hypothetical protein
46spa0254767..55876 [+], 1110hypothetical protein
47spa0355889..57421 [+], 1533hypothetical protein
48spa0457736..58869 [+], 1134hypothetical protein
49s05459015..59707 [+], 693hypothetical proteinTrbB_I, T4SS component 
50traC59707..62106 [+], 2400TraCTraC_F, T4SS component 
51trsF62430..62942 [+], 513TrsFTraF, T4SS component 
52traW62893..64077 [+], 1185TraWTraW_F, T4SS component 
53traU64061..65089 [+], 1029TraUTraU_F, T4SS component 
54traN65092..68784 [+], 3693TraNTraN_F, T4SS component 
55spa0568947..69474 [-], 528hypothetical protein
56spa0669484..70257 [-], 774hypothetical protein
57s06370416..71018 [-], 603hypothetical protein
58s08971386..71712 [+], 327hypothetical protein
59ssb71728..72147 [+], 420hypothetical protein
60s06572227..73045 [+], 819hypothetical protein
61s06673333..74349 [+], 1017hypothetical protein
62s06774442..75518 [+], 1077hypothetical protein
63s08875518..76285 [+], 768hypothetical protein
64s06876384..77337 [+], 954hypothetical protein
65s06977399..77839 [+], 441hypothetical protein
66s07077909..79564 [+], 1656hypothetical protein
67s07179648..80145 [+], 498hypothetical protein
68s07280577..81644 [+], 1068hypothetical protein
69IS1081904..83112 [-], 1209IS10
70spa0783835..86330 [+], 2496hypothetical protein
71spa0886334..87803 [+], 1470hypothetical protein
72spa0987816..89477 [+], 1662hypothetical protein
73spa1089470..90177 [+], 708hypothetical protein
74spa1190286..91680 [+], 1395hypothetical protein
75vrlR91687..92181 [+], 495-
76traF92280..93224 [+], 945TraFTraF_F, T4SS component 
77traH93227..94615 [+], 1389TraHTraH_F, T4SS component 
78traG94619..98188 [+], 3570TraGTraG_F, T4SS component 
79eex98221..98652 [-], 432Eex
80setC98710..99243 [-], 534SetC
81setD99240..99539 [-], 300SetD
82s083100071..100679 [-], 609hypothetical protein
83s084100720..101589 [-], 870hypothetical protein
84setQ101645..101896 [-], 252SetQ
85setR102014..102661 [+], 648SetR
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins79Fasta
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PubMed:20041216] in_silico
(2) Ceccarelli D; Daccord A; Rene M; Burrus V (2008). Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PubMed:18539733] experimental
(3) Osorio CR; Marrero J; Wozniak RA; Lemos ML; Burrus V; Waldor MK (2008). Genomic and functional analysis of ICEPdaSpa1, a fish-pathogen-derived SXT-related integrating conjugative element that can mobilize a virulence plasmid. J Bacteriol. 190(9):3353-61. [PubMed:18326579] experimental
(4) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PubMed:17307849] experimental
(5) Juiz-Rio S; Osorio CR; de Lorenzo V; Lemos ML (2005). Subtractive hybridization reveals a high genetic diversity in the fish pathogen Photobacterium damselae subsp. piscicida: evidence of a SXT-like element. Microbiology. 151(Pt 8):2659-69. [PubMed:16079344] experimental
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU