ICEberg
I. Information of ICE
ICEberg ID374
Name HPI-ICEEh1 This is a predicted ICE derived from literature
OrganismEnterobacter hormaechei 05-545
Size (bp)66234
GC content [Genome] (%)52.36
Insertion sitetRNA-Asn
FunctionPathogenicity
Species that ICE can be transferred to-
Nucleotide SequenceFN297818 (complete ICE sequence in this GenBank file)
Replicon[FN297818]
Coordinates42411..108644 
Putative oriT region coordinates: 88554..88677;   oriTDB id:  200012
CCGATTAGGCGCGACCACCCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC
TAAACGCGCGTCTTAAAGGGGGTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of HPI-ICEEh1 is not available.



The graph information of HPI-ICEEh1 components from FN297818
Complete gene list of HPI-ICEEh1 from FN297818
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-37601..38842 [-], 1242hypothetical protein
2-38861..39280 [-], 420hypothetical protein
3-39392..39895 [+], 504putative Fe2+/Zn2+ uptake regulation protein
4-40101..41120 [-], 1020hypothetical protein
5-41120..42106 [-], 987putative iron(III) ABC-transporter periplasmic-binding protein
6intB42589..43851 [+], 1263integraseIntegrase 
7ybtS44045..45349 [-], 1305salicylate synthetase
8ybtX45377..46780 [-], 1404cytoplasmic transmembrane protein
9ybtQ46650..48452 [-], 1803ABC-transporter protein
10ybtP48439..50241 [-], 1803inner membrane ABC-transporter
11ybtA50408..51367 [+], 960transcriptional regulator
12irp251558..57665 [+], 6108High Molecular Weight Protein 2 (HMWP2)
13irp157753..67244 [+], 9492High Molecular Weight Protein 1 (HMWP1)
14ybtU67145..68341 [+], 1197thiazolinyl-S-HMWP1 reductase
15ybtT68353..69141 [+], 789yersiniabactin biosynthetic protein
16ybtE69145..70722 [+], 1578yersiniabactin biosynthetic protein
17fyuA70853..72874 [+], 2022yersiniabactin/pesticin receptor
18-73747..74673 [+], 927hypothetical protein
19-75187..75768 [+], 582hypothetical protein
20-76905..77189 [-], 285hypothetical protein
21virB1-like277213..77923 [+], 711putative Pilx1/VirB1-like proteinVirB1, T4SS component 
22virB2-like277923..78216 [+], 294putative VirB2-like proteinVirB2, T4SS component 
23virB3-4-like278229..80967 [+], 2739putative Pilx3-4/VirB3-4-like proteinVirB4, T4SS component 
24virB5-like280985..81692 [+], 708putative Pilx5/VirB5-like proteinVirB5, T4SS component 
25-81700..81942 [+], 243hypothetical proteinMagB05, T4SS component 
26virB6-like281946..83019 [+], 1074putative Pilx6/VirB6-like proteinVirB6, T4SS component 
27-83111..83248 [+], 138hypothetical proteinVirB7, T4SS component 
28virB8-like283241..83924 [+], 684putative PilX8-VirB8-like proteinVirB8, T4SS component 
29virB9-like283921..84829 [+], 909putative Pilx9/VirB9-like proteinVirB9, T4SS component 
30virB10-like284873..86123 [+], 1251putative Pilx10/VirB10-like proteinVirB10, T4SS component 
31virB11-like286113..87138 [+], 1026putative Pilx11/VirB11-like proteinVirB11, T4SS component 
32-87135..87533 [+], 399hypothetical protein
33-87569..87874 [+], 306YggA-like protein
34-87908..88213 [+], 306hypothetical protein
35-88324..88626 [+], 303hypothetical protein
36mobB-like288893..90782 [+], 1890putative MobB-like proteinVirD4, T4SS component 
37mobC-like290792..91538 [+], 747MobC-like protein
38-91599..95123 [-], 3525helicase-like protein
39vrlR-like295107..95886 [-], 780putative VrlR-like protein
40-96190..97137 [-], 948putative primase-like protein
41-97978..98337 [+], 360hypothetical protein
42-98347..98949 [+], 603hypothetical protein
43-99295..99831 [-], 537putative VC0181-like protein
44-99743..101512 [-], 1770putative VC180-like protein
45-101512..102810 [-], 1299putative VC0179-like protein
46-102810..103895 [-], 1086VC0178-like protein
47-104305..106023 [-], 1719hypothetical protein
48-106111..107004 [-], 894hypothetical protein
49-107020..107982 [-], 963putative patatin-like protein
50-108973..109299 [+], 327hypothetical protein
51-109923..111449 [+], 1527hypothetical protein
52-111555..112727 [-], 1173hypothetical protein
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins44Fasta
(1) Paauw A; Leverstein-van Hall MA; Verhoef J; Fluit AC (2010). Evolution in quantum leaps: multiple combinatorial transfers of HPI and other genetic modules in Enterobacteriaceae. PLoS One. 5(1):e8662. [PubMed:20084283]
 

Genomics & Bioinformatics Group in MML, SJTU