ICEberg
I. Information of ICE
ICEberg ID364
Name Tn5253 This ICE is derived from GenBank without published report
OrganismStreptococcus pneumoniae DP1322
Size (bp)64528
GC content [Genome] (%)35.46
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceEU351020 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates833..65360 
Putative oriT region coordinates: 32531..32663;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase coordinates: 31315..32520;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of Tn5253 is not available.



The graph information of Tn5253 components from EU351020
Complete gene list of Tn5253 from EU351020
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1spr10421..353 [+], 353IgA-specific zinc metalloproteinase
2-1070..1243 [+], 174unknown
3repA1240..2019 [+], 780RepA
4-2020..2121 [+], 102unknown
5-2118..3476 [+], 1359methyltransferase
6-3460..3909 [+], 450unknown
7-3902..4282 [+], 381unknown
8-4295..4528 [+], 234unknown
9-4531..5118 [+], 588putative protease
10-5246..5836 [+], 591abortive infection protein AbiEi
11-5836..6672 [+], 837abortive infection protein AbiEii
12-6955..7254 [+], 300unknown
13-7244..7732 [+], 489unknown
14traG7732..9609 [+], 1878TraG protein
15-9630..9872 [+], 243unknown
16-9889..10743 [+], 855unknownPrgH, T4SS component 
17-10797..11156 [+], 360unknown
18virB411107..13464 [+], 2358type IV secretion protein VirB4PrgJ, T4SS component 
19-13476..16289 [+], 2814putative peptidoglycan hydrolasePrgK, T4SS component 
20-16341..16469 [+], 129unknown
21-16591..16785 [-], 195truncated ISSth5 transposase
22int17306..18523 [-], 1218integraseIntegrase 
23xis18605..18808 [-], 204excisionase
24-18792..19043 [+], 252unknown
25-19269..19499 [-], 231unknown
26-19496..19918 [-], 423putative sigma factor
27-20147..20293 [-], 147unknown
28-20423..20776 [+], 354putative transcriptional regulator
29-20836..21024 [-], 189unknown
30tet(M)21122..23041 [-], 1920tetracycline resistance protein Tet(M)
31-23057..23143 [-], 87tet(M) leader peptide
32-23418..24350 [-], 933unknownOrf13_Tn, T4SS component 
33-24347..25348 [-], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
34-25345..27522 [-], 2178unknownOrf15_Tn, T4SS component 
35virB427525..29972 [-], 2448type IV secretion protein VirB4Orf16_Tn, T4SS component 
36-29956..30462 [-], 507unknownOrf17_Tn, T4SS component 
37ardA30437..30934 [-], 498antirestriction protein ArdA
38-31051..31272 [-], 222unknownOrf19_Tn, T4SS component 
39-31315..32520 [-], 1206relaxaseRelaxase, MOBT Family
40-32698..34083 [-], 1386putative FtsK-SpoIIIE family proteinOrf21_Tn, T4SS component 
41-34112..34495 [-], 384unknown
42-34514..34828 [-], 315unknown
43-34851..34970 [-], 120unknown
44-35267..35998 [+], 732putative ATP-binding protein
45-36016..37332 [+], 1317putative permease protein
46-37388..37492 [-], 105unknown
47-37763..38173 [+], 411unknown
48-38221..44307 [+], 6087putative restriction-modification protein
49-44382..44666 [+], 285unknown
50-44680..44976 [+], 297unknown
51-44990..45187 [-], 198unknown
52-45347..45988 [+], 642unknownPrgL, T4SS component 
53-45998..47083 [+], 1086unknown
54-47134..47367 [+], 234unknown
55-47364..47747 [+], 384unknown
56-47785..48057 [+], 273unknown
57pezA48125..48601 [+], 477antitoxin PezA
58pezT48601..49359 [+], 759toxin PezT
59-49835..50623 [+], 789unknown
60-50862..51110 [+], 249unknown
61-51281..51931 [+], 651chloramphenicol acetyl transferase CAT
62-52236..52325 [-], 90unknown
63-52442..52666 [-], 225unknown
64-52796..53641 [-], 846replication protein
65-53657..53926 [+], 270unknown
66-54016..54753 [+], 738truncated neopullulanase
67-54832..55476 [+], 645unknown
68pezA55752..56228 [+], 477antitoxin PezA
69pezT56228..56998 [+], 771toxin PezT
70umuD57255..57938 [+], 684UV resistance protein UmuD
71umuC57941..59356 [+], 1416UV resistance protein UmuC
72-59410..59718 [+], 309unknown
73-59708..59998 [+], 291unknown
74-60293..60649 [+], 357unknown
75-60654..61019 [+], 366mobilization protein MobC
76-61006..62835 [+], 1830relaxase
77-62939..63166 [+], 228putative transcriptional regulator
78-63214..63393 [-], 180unknown
79xis63433..63666 [+], 234excisionase
80int63751..65259 [+], 1509integrase
81spr104365341..66192 [+], 852ribosomal biogenesis GTPase
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins79Fasta
-