ICEberg
I. Information of ICE
ICEberg ID329
Name Tn6079 This ICE is derived from GenBank without published report
OrganismUncultured bacterium MID12
Size (bp)28411
GC content [Genome] (%)38.24
Insertion siteAT rich regions
FunctionTetracycline and erythromycin resistance
Species that ICE can be transferred to-
Nucleotide SequenceGU951538 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates462..28872 
Putative oriT region coordinates: 24295..24321;   oriTDB id:  100183
TTGAGAGATGACTGGTAAATTTAAAAA
Putative relaxase coordinates: 21068..22330; Locus tag: MID12_8;  Family:  MOBV


II. ICE interaction with IME/CIME/

The interaction information of Tn6079 is not available.



The graph information of Tn6079 components from GU951538
Complete gene list of Tn6079 from GU951538
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1MID12_1682..3804 [+], 3123hypothetical protein
2MID12_23817..3966 [+], 150Tn916-like orf24 protein
3MID12_34043..4369 [+], 327Tn916-like orf23 protein
4MID12_44385..4768 [+], 384Tn916-like orf22 protein
5MID12_54870..5634 [+], 765putative metallo-beta-lactamase domain protein
6MID12_65733..7124 [+], 1392Tn916-like orf21 proteinOrf21_Tn, T4SS component 
7MID12_77219..7608 [+], 390hypothetical protein
8MID12_87968..8957 [+], 990Tn916 orf20 proteinRelaxase, MOBT Family
9MID12_99000..9221 [+], 222Tn916 orf19 proteinOrf19_Tn, T4SS component 
10MID12_109338..9835 [+], 498Tn916 orf18 protein
11MID12_119810..10316 [+], 507Tn916 orf17 proteinOrf17_Tn, T4SS component 
12MID12_1210300..12747 [+], 2448Tn916-like orf16 proteinOrf16_Tn, T4SS component 
13MID12_1312816..14927 [+], 2112Tn916-like orf15 proteinOrf15_Tn, T4SS component 
14MID12_1414924..15805 [+], 882Tn916-like orf14 proteinOrf14_Tn, T4SS component 
15MID12_1515802..16737 [+], 936Tn916-like orf13 proteinOrf13_Tn, T4SS component 
16MID12_1617012..17098 [+], 87Tn916-like orf12 protein
17tet(M)17114..19033 [+], 1920tetracycline resistant ribosomal protection protein
18tet(L)19131..20504 [+], 1374tetracycline resistent efflux protein
19pre/mob21068..22330 [+], 1263Pre/Mob proteinRelaxase, MOBV Family
20repB22554..23474 [+], 921RepB protein
21MID12_2123497..24183 [-], 687IS1216-like transposase
22erm(T)24929..25663 [-], 735erythromycin rRNA methylase protein
23erm(T) leader25723..25782 [-], 60erm(T) leader peptide
24MID12_2425884..26570 [-], 687IS1216-like transposase
25MID12_2526955..27206 [-], 252Tn916-like orf5 protein
26xis-tn27190..27393 [+], 204Tn916-like excisionase
27int-tn27475..28692 [+], 1218Tn916-like integrase proteinIntegrase 
28rpmG28970..29119 [-], 150L33 50S ribosomal protein
29rpmF29135..29311 [-], 177L32 50S ribosomal protein
30hisS29628..30905 [+], 1278histidyl-tRNA synthetase
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins27Fasta
-

Genomics & Bioinformatics Group in MML, SJTU