![]() | 329 |
![]() ![]() | Tn6079 ![]() |
![]() | Uncultured bacterium MID12 |
![]() | 28411 |
![]() | 38.24 |
![]() | AT rich regions |
![]() | Tetracycline and erythromycin resistance |
![]() | - |
![]() | GU951538 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 462..28872 |
![]() ![]() | coordinates: 24295..24321; oriTDB id: 100183 TTGAGAGATGACTGGTAAATTTAAAAA |
![]() ![]() | coordinates: 21068..22330; Locus tag: MID12_8; Family: MOBV |
The graph information of Tn6079 components from GU951538 | |||||
![]() | |||||
Complete gene list of Tn6079 from GU951538 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | MID12_1 | 682..3804 [+], 3123 | hypothetical protein | ||
2 | MID12_2 | 3817..3966 [+], 150 | Tn916-like orf24 protein | ||
3 | MID12_3 | 4043..4369 [+], 327 | Tn916-like orf23 protein | ||
4 | MID12_4 | 4385..4768 [+], 384 | Tn916-like orf22 protein | ||
5 | MID12_5 | 4870..5634 [+], 765 | putative metallo-beta-lactamase domain protein | ||
6 | MID12_6 | 5733..7124 [+], 1392 | Tn916-like orf21 protein | Orf21_Tn, T4SS component | |
7 | MID12_7 | 7219..7608 [+], 390 | hypothetical protein | ||
8 | MID12_8 | 7968..8957 [+], 990 | Tn916 orf20 protein | Relaxase, MOBT Family | |
9 | MID12_9 | 9000..9221 [+], 222 | Tn916 orf19 protein | Orf19_Tn, T4SS component | |
10 | MID12_10 | 9338..9835 [+], 498 | Tn916 orf18 protein | ||
11 | MID12_11 | 9810..10316 [+], 507 | Tn916 orf17 protein | Orf17_Tn, T4SS component | |
12 | MID12_12 | 10300..12747 [+], 2448 | Tn916-like orf16 protein | Orf16_Tn, T4SS component | |
13 | MID12_13 | 12816..14927 [+], 2112 | Tn916-like orf15 protein | Orf15_Tn, T4SS component | |
14 | MID12_14 | 14924..15805 [+], 882 | Tn916-like orf14 protein | Orf14_Tn, T4SS component | |
15 | MID12_15 | 15802..16737 [+], 936 | Tn916-like orf13 protein | Orf13_Tn, T4SS component | |
16 | MID12_16 | 17012..17098 [+], 87 | Tn916-like orf12 protein | ||
17 | tet(M) | 17114..19033 [+], 1920 | tetracycline resistant ribosomal protection protein | ||
18 | tet(L) | 19131..20504 [+], 1374 | tetracycline resistent efflux protein | ||
19 | pre/mob | 21068..22330 [+], 1263 | Pre/Mob protein | Relaxase, MOBV Family | |
20 | repB | 22554..23474 [+], 921 | RepB protein | ||
21 | MID12_21 | 23497..24183 [-], 687 | IS1216-like transposase | ||
22 | erm(T) | 24929..25663 [-], 735 | erythromycin rRNA methylase protein | ||
23 | erm(T) leader | 25723..25782 [-], 60 | erm(T) leader peptide | ||
24 | MID12_24 | 25884..26570 [-], 687 | IS1216-like transposase | ||
25 | MID12_25 | 26955..27206 [-], 252 | Tn916-like orf5 protein | ||
26 | xis-tn | 27190..27393 [+], 204 | Tn916-like excisionase | ||
27 | int-tn | 27475..28692 [+], 1218 | Tn916-like integrase protein | Integrase | |
28 | rpmG | 28970..29119 [-], 150 | L33 50S ribosomal protein | ||
29 | rpmF | 29135..29311 [-], 177 | L32 50S ribosomal protein | ||
30 | hisS | 29628..30905 [+], 1278 | histidyl-tRNA synthetase |
- |