oriTDB
The information of the oriT region
oriTDB accession number 100183
Name oriT_pMV158  experimental
Sequence Completeness core
oriT length 41 nt
oriT sequence CACTTTATGAATATAAAGTATAGTGTGTTATACTTTACATG
IR (inverted repeat)[2-8] [13-19] nt  (ACTTTAT..ATAAAGT)
Location of nic site [27-28] nt
Conserved sequence flanking the
  nic site
TAGTGTG|TTAT
Note The conserved recombination site (RSA): AAGTATAGTGTG|TTATACT
L:2-8;R:13-19;D:27-28
Visualization of oriT structure (The oriT was characterized experimentally)
1...5....10....15....20....25....30....35....40....45....50....55....60
1

CACTTTATGAATATAAAGTATAGTGTGTTATACTTTACATG

Reference
[1] Grohmann E et al (2003) Conjugative plasmid transfer in gram-positive bacteria. Microbiol Mol Biol Rev. 67(2):277-301. [PMID:12794193]
[2] Grohmann E et al (1999) Mobilisation of the streptococcal plasmid pMV158: interactions of MobM protein with its cognate oriT DNA region. Mol Gen Genet. 261(4-5):707-15. [PMID:10394908]
[3] Guzmán LM et al (1997) The mobilization protein, MobM, of the streptococcal plasmid pMV158 specifically cleaves supercoiled DNA at the plasmid oriT. Mol Gen Genet. 266(4):688-702. [PMID:9102462]
[4] Priebe SD et al (1989) Region of the streptococcal plasmid pMV158 required for conjugative mobilization. J Bacteriol. 171(9):4778-84. [PMID:2768188]
[5] Farías ME et al (2000) Conjugal transfer of plasmid pMV158: uncoupling of the pMV158 origin of transfer from the mobilization gene mobM, and modulation of pMV158 transfer in Escherichia coli mediated by IncP plasmids. Microbiology. 146 (Pt 9):2259-65. [PMID:10974113]
[6] Turgeon N et al (2001) Isolation and characterization of a Streptococcus thermophilus plasmid closely related to the pMV158 family. Plasmid. 45(3):171-83. [PMID:11407913]
[7] Francia MV et al (2004) A classification scheme for mobilization regions of bacterial plasmids. FEMS Microbiol Rev. 28(1):79-100. [PMID:14975531]
[8] Alippi AM et al (2014) Tetracycline-resistance encoding plasmids from Paenibacillus larvae, the causal agent of American foulbrood disease, isolated from commercial honeys. Int Microbiol. 17(1):49-61. [PMID:25296446]
[9] Tomita H et al (2005) Genetic analysis of transfer-related regions of the vancomycin resistance Enterococcus conjugative plasmid pHTbeta: identification of oriT and a putative relaxase gene. J Bacteriol. 187(22):7727-37. [PMID:16267297]