ICEberg
I. Information of ICE
ICEberg ID326
Name Tn6087 This ICE is derived from experimental literature
ICEO ID ICEO_0000356
OrganismStreptococcus oralis F.MI.5
Size (bp)21169
GC content [Genome] (%)38.23
Insertion siteAT rich regions
FunctionTetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceHQ663849 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..21169 
Putative oriT region coordinates: 2501..2633;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTTTGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of Tn6087 is not available.



The graph information of Tn6087 components from HQ663849
Complete gene list of Tn6087 from HQ663849
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-194..265 [+], 72hypothetical protein
2-336..650 [+], 315hypothetical protein
3-666..1052 [+], 387hypothetical protein
4-1081..2466 [+], 1386hypothetical proteinOrf21_Tn, T4SS component 
5-3892..4113 [+], 222hypothetical proteinOrf19_Tn, T4SS component 
6-4230..4727 [+], 498hypothetical protein
7-4702..5208 [+], 507hypothetical proteinOrf17_Tn, T4SS component 
8-5192..5620 [+], 429hypothetical proteinOrf16_Tn, T4SS component 
9IS1216 tnp29158..9844 [-], 687hypothetical protein
10-10358..10684 [-], 327small multidrug resistance protein
11-10950..11255 [+], 306hypothetical protein
12IS1216 tnp111475..12161 [-], 687hypothetical protein
13-12950..13951 [+], 1002hypothetical proteinOrf14_Tn, T4SS component 
14-13948..14883 [+], 936hypothetical proteinOrf13_Tn, T4SS component 
15-15158..15244 [+], 87hypothetical protein
16tetM15260..17179 [+], 1920TetMAR 
17-17277..17465 [+], 189hypothetical protein
18-17525..17878 [-], 354hypothetical protein
19-18083..18154 [+], 72hypothetical protein
20-18332..18805 [+], 474hypothetical protein
21-18802..19032 [+], 231hypothetical protein
22-19258..19509 [-], 252hypothetical protein
23xis19493..19696 [+], 204hypothetical protein
24int19778..20995 [+], 1218hypothetical proteinIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins24Fasta
(1) Ciric L et al. (2011). Antibiotic and antiseptic resistance genes are linked on a novel mobile genetic element: Tn6087. J Antimicrob Chemother. 66(10):2235-9. [PubMed:21816764] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU