ICEberg
I. Information of ICE
ICEberg ID325
Name Tn2010 This ICE is derived from experimental literature
ICEO ID ICEO_0000265
OrganismStreptococcus pneumoniae 05P294
Size (bp)26390
GC content [Genome] (%)37.89
Insertion siteAT rich regions
FunctionErythromycin and tetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceAB426620 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..26390 
Putative oriT region coordinates: 2501..2633;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2860..3906;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of Tn2010 is not available.



The graph information of Tn2010 components from AB426620
Complete gene list of Tn2010 from AB426620
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-194..313 [+], 120hypothetical protein
2-336..650 [+], 315hypothetical protein
3-666..1052 [+], 387hypothetical protein
4-1081..2466 [+], 1386hypothetical proteinOrf21_Tn, T4SS component 
5-2860..3906 [+], 1047hypothetical proteinRelaxase, MOBT Family
6-3896..4063 [+], 168MLS leader peptide
7-4112..4195 [+], 84MLS leader peptide
8ermB4320..5057 [+], 738MLS methylaseAR 
9-5002..5193 [+], 192hypothetical protein
10-5314..6561 [-], 1248hypothetical protein
11-6741..6962 [+], 222hypothetical proteinOrf19_Tn, T4SS component 
12-7079..7576 [+], 498hypothetical protein
13-7551..8057 [+], 507hypothetical proteinOrf17_Tn, T4SS component 
14-8041..10488 [+], 2448hypothetical proteinOrf16_Tn, T4SS component 
15-10491..12668 [+], 2178hypothetical proteinOrf15_Tn, T4SS component 
16-12665..13666 [+], 1002hypothetical proteinOrf14_Tn, T4SS component 
17-13663..14595 [+], 933hypothetical proteinOrf13_Tn, T4SS component 
18-14870..14956 [+], 87hypothetical protein
19tetM14972..16891 [+], 1920tetracycline resistance proteinAR 
20-17070..17258 [+], 189hypothetical protein
21-17497..17832 [+], 336hypothetical protein
22-17845..18213 [+], 369hypothetical protein
23-18200..18499 [+], 300hypothetical protein
24mel18617..20080 [-], 1464mel protein
25mefE20200..21417 [-], 1218macrolide efflux protein EAR 
26-21803..21988 [-], 186hypothetical protein
27-22746..23099 [-], 354hypothetical protein
28-23304..23375 [+], 72hypothetical protein
29-23553..24026 [+], 474hypothetical protein
30-24023..24253 [+], 231hypothetical protein
31-24479..24730 [-], 252hypothetical protein
32-24714..24917 [+], 204Xis-Tn protein
33-24999..26216 [+], 1218Int-Tn proteinIntegrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins33Fasta
(1) Li Y; Tomita H; Lv Y; Liu J; Xue F; Zheng B; Ike Y (2011). Molecular characterization of erm(B)- and mef(E)-mediated erythromycin-resistant Streptococcus pneumoniae in China and complete DNA sequence of Tn2010. J Appl Microbiol. 110(1):254-65. [PubMed:20961364] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU