![]() | 325 |
![]() ![]() | Tn2010 ![]() |
![]() ![]() | ICEO_0000265 |
![]() | Streptococcus pneumoniae 05P294 |
![]() | 26390 |
![]() | 37.89 |
![]() | AT rich regions |
![]() | Erythromycin and tetracycline resistance |
![]() | - |
![]() | AB426620 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..26390 |
![]() ![]() | coordinates: 2501..2633; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 2860..3906; Family: MOBT |
The graph information of Tn2010 components from AB426620 | |||||
![]() | |||||
Complete gene list of Tn2010 from AB426620 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 194..313 [+], 120 | hypothetical protein | ||
2 | - | 336..650 [+], 315 | hypothetical protein | ||
3 | - | 666..1052 [+], 387 | hypothetical protein | ||
4 | - | 1081..2466 [+], 1386 | hypothetical protein | Orf21_Tn, T4SS component | |
5 | - | 2860..3906 [+], 1047 | hypothetical protein | Relaxase, MOBT Family | |
6 | - | 3896..4063 [+], 168 | MLS leader peptide | ||
7 | - | 4112..4195 [+], 84 | MLS leader peptide | ||
8 | ermB | 4320..5057 [+], 738 | MLS methylase | AR | |
9 | - | 5002..5193 [+], 192 | hypothetical protein | ||
10 | - | 5314..6561 [-], 1248 | hypothetical protein | ||
11 | - | 6741..6962 [+], 222 | hypothetical protein | Orf19_Tn, T4SS component | |
12 | - | 7079..7576 [+], 498 | hypothetical protein | ||
13 | - | 7551..8057 [+], 507 | hypothetical protein | Orf17_Tn, T4SS component | |
14 | - | 8041..10488 [+], 2448 | hypothetical protein | Orf16_Tn, T4SS component | |
15 | - | 10491..12668 [+], 2178 | hypothetical protein | Orf15_Tn, T4SS component | |
16 | - | 12665..13666 [+], 1002 | hypothetical protein | Orf14_Tn, T4SS component | |
17 | - | 13663..14595 [+], 933 | hypothetical protein | Orf13_Tn, T4SS component | |
18 | - | 14870..14956 [+], 87 | hypothetical protein | ||
19 | tetM | 14972..16891 [+], 1920 | tetracycline resistance protein | AR | |
20 | - | 17070..17258 [+], 189 | hypothetical protein | ||
21 | - | 17497..17832 [+], 336 | hypothetical protein | ||
22 | - | 17845..18213 [+], 369 | hypothetical protein | ||
23 | - | 18200..18499 [+], 300 | hypothetical protein | ||
24 | mel | 18617..20080 [-], 1464 | mel protein | ||
25 | mefE | 20200..21417 [-], 1218 | macrolide efflux protein E | AR | |
26 | - | 21803..21988 [-], 186 | hypothetical protein | ||
27 | - | 22746..23099 [-], 354 | hypothetical protein | ||
28 | - | 23304..23375 [+], 72 | hypothetical protein | ||
29 | - | 23553..24026 [+], 474 | hypothetical protein | ||
30 | - | 24023..24253 [+], 231 | hypothetical protein | ||
31 | - | 24479..24730 [-], 252 | hypothetical protein | ||
32 | - | 24714..24917 [+], 204 | Xis-Tn protein | ||
33 | - | 24999..26216 [+], 1218 | Int-Tn protein | Integrase |
(1) Li Y; Tomita H; Lv Y; Liu J; Xue F; Zheng B; Ike Y (2011). Molecular characterization of erm(B)- and mef(E)-mediated erythromycin-resistant Streptococcus pneumoniae in China and complete DNA sequence of Tn2010. J Appl Microbiol. 110(1):254-65. [PubMed:20961364] ![]() |
![]() |