ICEberg

ICE
Gene list
Download
References

I. Information of ICE

ICEberg ID	321
Name	Tn6003
ICEO ID	ICEO_0000264
Organism	Streptococcus pneumoniae Ar4
Size (bp)	25101
GC content [Genome] (%)	37.98
Insertion site	AT rich regions
Function	Erythromycin, aminoglycoside, streptothricin and tetracycline resistance
Species that ICE can be transferred to	-
Nucleotide Sequence	AM410044 (complete ICE sequence in this GenBank file)
Replicon	-
Coordinates	1..25101
Putative oriT region	coordinates: 2501..2633; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase	coordinates: 2860..4062; Family: MOB_T

II. ICE interaction with IME/CIME/

The interaction information of Tn6003 is not available.

The graph information of Tn6003 components from AM410044

Complete gene list of Tn6003 from AM410044
#	Gene	Coordinates [+/-], size (bp)	Product (GenBank annotation)	*Reannotation
1	-	194..283 [+], 90	truncated hypothetical protein
2	-	336..650 [+], 315	hypothetical protein
3	-	666..1052 [+], 387	hypothetical protein
4	-	1081..2466 [+], 1386	hypothetical protein	Orf21_Tn, T4SS component
5	-	2860..4062 [+], 1203	hypothetical protein	Relaxase, MOB_T Family
6	-	3895..4062 [+], 168	MLS leader peptide
7	ORFM0	4111..4194 [+], 84	MLS leader peptide
8	ermB	4319..5104 [+], 786	-
9	aadE	5107..5445 [+], 339	adenyltransferase
10	sat4	5454..5984 [+], 531	streptothricin acetyltransferase
11	aphA-3	6077..6871 [+], 795	aminoglycoside phosphotransferase type III	AR
12	-	7147..7719 [+], 573	hypothetical protein
13	-	8336..8419 [+], 84	MLS leader peptide
14	ermB	8544..9281 [+], 738	MLS methylase	AR
15	-	9226..9417 [+], 192	hypothetical protein
16	-	9538..10785 [-], 1248	putative transposase
17	-	10965..11186 [+], 222	hypothetical protein	Orf19_Tn, T4SS component
18	-	11303..11800 [+], 498	hypothetical protein
19	-	11775..12281 [+], 507	hypothetical protein	Orf17_Tn, T4SS component
20	-	12265..14712 [+], 2448	hypothetical protein	Orf16_Tn, T4SS component
21	-	14715..16892 [+], 2178	hypothetical protein	Orf15_Tn, T4SS component
22	-	16889..17674 [+], 786	hypothetical protein	Orf14_Tn, T4SS component
23	-	17887..18819 [+], 933	hypothetical protein	Orf13_Tn, T4SS component
24	-	19094..19180 [+], 87	tet(M) leader peptide
25	tet(M)	19181..21113 [+], 1933	-
26	-	21211..21399 [+], 189	hypothetical protein
27	-	21459..21812 [-], 354	hypothetical protein
28	-	22017..22088 [+], 72	hypothetical protein
29	-	22266..22739 [+], 474	hypothetical protein
30	-	22736..22966 [+], 231	hypothetical protein
31	-	23187..23441 [-], 255	hypothetical protein
32	Xis-Tn	23425..23628 [+], 204	excisionase
33	Int-Tn	23710..24927 [+], 1218	integrase	Integrase

Gene may contribute to site-specific recombination

Element	No. of sequences	Download
Nucleotide sequences	1	Fasta
Proteins	31	Fasta

(1) Cochetti I; Tili E; Vecchi M; Manzin A; Mingoia M; Varaldo PE; Montanari MP (2007). New Tn916-related elements causing erm(B)-mediated erythromycin resistance in tetracycline-susceptible pneumococci. J Antimicrob Chemother. 60(1):127-31. [PubMed:17483548]

experimental literature