 ICEberg ID | 319 |
Name  | Tn6085a  |
| ICEO ID | ICEO_0000262 |
| Organism | Enterococcus faecium C68 |
| Size (bp) | 20789 |
| GC content [Genome] (%) | 38.46 |
| Insertion site | AT rich regions |
| Function | resistance to tetracycline and minocycline |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | HM243621 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 6653..27441 |
| Putative oriT region | coordinates: 9152..9284; oriTDB id: 200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
|
| Putative relaxase | - |
