ICEberg ID | 319 |
Name ![Inside the [ ] is an alias; Inside the { } is a additional remark of the ICE](images/symbol.jpg) | Tn6085a ![This ICE is derived from experimental literature This ICE is derived from experimental literature](images/experimental.png) |
ICEO ID ![ICEO is a biological ontology to represent, standardize, and integrate bacterial integrative and conjugative elements (ICEs) and to support computer-assisted reasoning.
Users can click the ICEO id link to browse the term in Ontobee, the default linked data server for most OBO Foundry library ontologies.
More information can be found in the ICEO homepage: https://github.com/ontoice/ICEO.](images/symbol.jpg) | ICEO_0000262 |
Organism | Enterococcus faecium C68 |
Size (bp) | 20789 |
GC content [Genome] (%) | 38.46 |
Insertion site | AT rich regions |
Function | resistance to tetracycline and minocycline |
Species that ICE can be transferred to | - |
Nucleotide Sequence | HM243621 (complete ICE sequence in this GenBank file) |
Replicon | - |
Coordinates | 6653..27441 |
Putative oriT region ![The putative oriT region detected by oriTfinder. Format: oriT_coordinate; oriTDB_id oriT_sequence](images/symbol.jpg) | coordinates: 9152..9284; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
Putative relaxase ![The putative relaxase detected by oriTfinder.](images/symbol.jpg) | - |