![]() | 309 |
![]() ![]() | ICESag2603VR-1 ![]() |
![]() | Streptococcus agalactiae 2603V/R |
![]() | 18031 |
![]() | 38.71[35.65] |
![]() | AT rich regions |
![]() | tetracycline resistance |
![]() | - |
![]() | AE009948 (complete ICE sequence in this genome) |
![]() | chromosome (2160267 bp, BioProject:330) [NC_004116] |
![]() | 923465..941495 |
![]() ![]() | coordinates: 938863..938995; oriTDB id: 200001 GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT |
![]() ![]() | - |
The graph information of ICESag2603VR-1 components from AE009948 | |||||
![]() | |||||
Complete gene list of ICESag2603VR-1 from AE009948 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | SAG0912 | 920281..921384 [+], 1104 | conserved hypothetical protein | ||
2 | cat | 921505..922143 [-], 639 | chloramphenicol acetyltransferase | ||
3 | SAG0914 | 922854..923465 [+], 612 | conserved hypothetical protein | ||
4 | SAG0915 | 923639..924856 [-], 1218 | Tn916, transposase | ||
5 | SAG0916 | 924938..925141 [-], 204 | Tn916, excisionase | ||
6 | SAG0917 | 925125..925376 [+], 252 | Tn916, hypothetical protein | ||
7 | SAG0918 | 925602..925832 [-], 231 | Tn916, hypothetical protein | ||
8 | SAG0919 | 925829..926302 [-], 474 | Tn916, hypothetical protein | ||
9 | SAG0920 | 926480..926551 [-], 72 | Tn916, hypothetical protein | ||
10 | SAG0921 | 926756..927109 [+], 354 | Tn916, transcriptional regulator, putative | ||
11 | SAG0922 | 927169..927354 [-], 186 | Tn916, hypothetical protein | ||
12 | tetM | 927455..929374 [-], 1920 | Tn916, tetracycline resistance protein | AR | |
13 | SAG0924 | 929390..929476 [-], 87 | Tn916, tetM leader peptide | ||
14 | SAG0925 | 929751..930683 [-], 933 | Tn916, hypothetical protein | ||
15 | SAG0926 | 930680..931681 [-], 1002 | Tn916, NLP/P60 family protein | ||
16 | SAG0927 | 931678..933855 [-], 2178 | membrane protein, putative | ||
17 | SAG0929 | 936288..936794 [-], 507 | Tn916, hypothetical protein | ||
18 | SAG0930 | 936769..937266 [-], 498 | Tn916, hypothetical protein | ||
19 | SAG0931 | 937383..937604 [-], 222 | Tn916, hypothetical protein | ||
20 | SAG0932 | 937647..938852 [-], 1206 | Tn916, transcriptional regulator, putative | ||
21 | SAG0933 | 939030..940415 [-], 1386 | Tn916, FtsK/SpoIIIE family protein | ||
22 | SAG0934 | 940444..940830 [-], 387 | Tn916, hypothetical protein | ||
23 | SAG0935 | 940846..941160 [-], 315 | Tn916, hypothetical protein | ||
24 | SAG0936 | 941183..941302 [-], 120 | Tn916, hypothetical protein | ||
25 | SAG0938 | 943034..943402 [-], 369 | transcriptional regulator, GntR family |
(1) Tettelin H; Masignani V; Cieslewicz MJ; Eisen JA; Peterson S; Wessels MR; Paulsen IT; Nelson KE; Margarit I; Read TD; Madoff LC; Wolf AM; Beanan MJ; Brinkac LM; Daugherty SC; DeBoy RT; Durkin AS; Kolonay JF; Madupu R; Lewis MR; Radune D; Fedorova NB; Scanlan D; Khouri H; Mulligan S; Carty HA; Cline RT; Van Aken SE; Gill J; Scarselli M; Mora M; Iacobini ET; Brettoni C; Galli G; Mariani M; Vegni F; Maione D; Rinaudo D; Rappuoli R; Telford JL; Kasper DL; Grandi G; Fraser CM (2002). Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae. Proc Natl Acad Sci U S A. 99(19):12391-6. [PubMed:12200547] |