ICEberg
I. Information of ICE
ICEberg ID309
Name ICESag2603VR-1 This is a predicted ICE derived from literature
OrganismStreptococcus agalactiae 2603V/R
Size (bp)18031
GC content [Genome] (%)38.71[35.65]
Insertion siteAT rich regions
Functiontetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceAE009948 (complete ICE sequence in this genome)
Replicon chromosome (2160267 bp, BioProject:330) [NC_004116]
Genome coordinates923465..941495 
Putative oriT region coordinates: 938863..938995;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICESag2603VR-1 is not available.



The graph information of ICESag2603VR-1 components from AE009948
Complete gene list of ICESag2603VR-1 from AE009948
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1SAG0912920281..921384 [+], 1104conserved hypothetical protein
2cat921505..922143 [-], 639chloramphenicol acetyltransferase
3SAG0914922854..923465 [+], 612conserved hypothetical protein
4SAG0915923639..924856 [-], 1218Tn916, transposase
5SAG0916924938..925141 [-], 204Tn916, excisionase
6SAG0917925125..925376 [+], 252Tn916, hypothetical protein
7SAG0918925602..925832 [-], 231Tn916, hypothetical protein
8SAG0919925829..926302 [-], 474Tn916, hypothetical protein
9SAG0920926480..926551 [-], 72Tn916, hypothetical protein
10SAG0921926756..927109 [+], 354Tn916, transcriptional regulator, putative
11SAG0922927169..927354 [-], 186Tn916, hypothetical protein
12tetM927455..929374 [-], 1920Tn916, tetracycline resistance proteinAR 
13SAG0924929390..929476 [-], 87Tn916, tetM leader peptide
14SAG0925929751..930683 [-], 933Tn916, hypothetical protein
15SAG0926930680..931681 [-], 1002Tn916, NLP/P60 family protein
16SAG0927931678..933855 [-], 2178membrane protein, putative
17SAG0929936288..936794 [-], 507Tn916, hypothetical protein
18SAG0930936769..937266 [-], 498Tn916, hypothetical protein
19SAG0931937383..937604 [-], 222Tn916, hypothetical protein
20SAG0932937647..938852 [-], 1206Tn916, transcriptional regulator, putative
21SAG0933939030..940415 [-], 1386Tn916, FtsK/SpoIIIE family protein
22SAG0934940444..940830 [-], 387Tn916, hypothetical protein
23SAG0935940846..941160 [-], 315Tn916, hypothetical protein
24SAG0936941183..941302 [-], 120Tn916, hypothetical protein
25SAG0938943034..943402 [-], 369transcriptional regulator, GntR family
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins21Fasta
(1) Tettelin H; Masignani V; Cieslewicz MJ; Eisen JA; Peterson S; Wessels MR; Paulsen IT; Nelson KE; Margarit I; Read TD; Madoff LC; Wolf AM; Beanan MJ; Brinkac LM; Daugherty SC; DeBoy RT; Durkin AS; Kolonay JF; Madupu R; Lewis MR; Radune D; Fedorova NB; Scanlan D; Khouri H; Mulligan S; Carty HA; Cline RT; Van Aken SE; Gill J; Scarselli M; Mora M; Iacobini ET; Brettoni C; Galli G; Mariani M; Vegni F; Maione D; Rinaudo D; Rappuoli R; Telford JL; Kasper DL; Grandi G; Fraser CM (2002). Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae. Proc Natl Acad Sci U S A. 99(19):12391-6. [PubMed:12200547]
 

Genomics & Bioinformatics Group in MML, SJTU