ICEberg
I. Information of ICE
ICEberg ID308
Name ICESpaNUF1049 This ICE is derived from experimental literature
ICEO ID ICEO_0000260
OrganismStreptococcus parauberis NUF1049
Size (bp)18031
GC content [Genome] (%)38.71
Insertion siteAT rich regions
Functiontetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceAB468159 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates3016..21046 
Putative oriT region coordinates: 2501..2633;   oriTDB id:  200001
TTATTGTTGTAATAATTAATATTTTTTATAATAGCTTGTTCTGTAATAATCCGACCCTCAACAGGTATAC
CTGTGATTTGAGCTACTAAATTAAGATGAGCATCCTAGGCTGTTTTATCTAAACCCAAAGTCT
Putative relaxase coordinates: 5875..6864; Gene: O20;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpaNUF1049 is not available.



The graph information of ICESpaNUF1049 components from AB468159
Complete gene list of ICESpaNUF1049 from AB468159
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1Sp-O1842..1381 [+], 540hypothetic protein
2Sp-O21390..2379 [+], 990hypothetical protein
3O243209..3328 [+], 120hypothetical protein
4O233351..3665 [+], 315hypothetic protein
5O223681..4067 [+], 387hypothetic protein
6O214096..5481 [+], 1386hypothetic proteinOrf21_Tn, T4SS component 
7O205875..6864 [+], 990hypothetic proteinRelaxase, MOBT Family
8O196907..7128 [+], 222hypothetic proteinOrf19_Tn, T4SS component 
9O187245..7742 [+], 498hypothetic protein
10O177717..8223 [+], 507hypothetic proteinOrf17_Tn, T4SS component 
11O168207..10654 [+], 2448hypothetic proteinOrf16_Tn, T4SS component 
12O1510657..12921 [+], 2265hypothetic proteinOrf15_Tn, T4SS component 
13O1412830..13831 [+], 1002hypothetic proteinOrf14_Tn, T4SS component 
14O1313828..14760 [+], 933hypothetic proteinOrf13_Tn, T4SS component 
15O1215035..15121 [+], 87tet(M) leader peptide
16tet(M)15137..17056 [+], 1920Tn916-like_tet(M)AR 
17O617154..17342 [+], 189hypothetic protein
18O917402..17755 [-], 354putative transcriptional regulator
19O1017960..18031 [+], 72hypothetic protein
20O718209..18682 [+], 474hypothetic protein
21O818679..18909 [+], 231hypothetic protein
22O519135..19386 [-], 252hypothetic protein
23xis-Tn19370..19573 [+], 204Tn-excisionase
24int-Tn19898..20872 [+], 975integraseIntegrase 
25Sp-O321126..22313 [-], 1188hypothetic protein
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins22Fasta
(1) Meng F; Kanai K; Yoshikoshi K (2009). Structural characterization of Tn916-like element in Streptococcus parauberis serotype II strains isolated from diseased Japanese flounder. Lett Appl Microbiol. 48(6):770-6. [PubMed:19344360] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU