I. Information of ICE

ICEberg ID	307
Name	Tn916(RST11)
ICEO ID	ICEO_0000259
Organism	Staphylococcus rostri RST11
Size (bp)	18032
GC content [Genome] (%)	38.7
Insertion site	AT rich regions
Function	tetracycline resistance
Species that ICE can be transferred to	-
Nucleotide Sequence	FN550102 (complete ICE sequence in this GenBank file)
Replicon	-
Coordinates	1..18032
Putative oriT region	coordinates: 2501..2633;   oriTDB id:  200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase	coordinates: 2860..3849;   Family:  MOBT

II. ICE interaction with IME/CIME/

The interaction information of Tn916(RST11) is not available.

The graph information of Tn916(RST11) components from FN550102
Complete gene list of Tn916(RST11) from FN550102
#	Gene	Coordinates [+/-], size (bp)	Product  (GenBank annotation)	*Reannotation
1	-	194..313 [+], 120	hypothetical protein
2	-	336..650 [+], 315	conjugative transposon protein
3	-	666..1052 [+], 387	conjugative transposon protein
4	-	1081..2466 [+], 1386	hypothetical protein	Orf21_Tn, T4SS component
5	-	2860..3849 [+], 990	putative transcriptional regulator	Relaxase, MOBT Family
6	-	3892..4113 [+], 222	conjugative transposon protein	Orf19_Tn, T4SS component
7	-	4230..4727 [+], 498	conjugative transposon protein
8	-	4702..5208 [+], 507	conjugative transposon protein	Orf17_Tn, T4SS component
9	-	5192..7639 [+], 2448	putative regulatory protein	Orf16_Tn, T4SS component
10	-	7642..9819 [+], 2178	putative membrane protein	Orf15_Tn, T4SS component
11	-	9816..10817 [+], 1002	putative membrane protein	Orf14_Tn, T4SS component
12	-	10814..11746 [+], 933	putative membrane protein	Orf13_Tn, T4SS component
13	-	12021..12107 [+], 87	tetM leader peptide
14	tetM	12108..14042 [+], 1935	tetracycline resistance protein	AR
15	-	14140..14328 [+], 189	putative transcriptional regulator
16	-	14388..14741 [+], 354	-
17	-	14946..15017 [+], 72	putative ATP-binding protein
18	-	15195..15668 [+], 474	putative regulatory protein
19	-	15665..15895 [+], 231	putative ATP-binding protein
20	-	16121..16372 [-], 252	excisionase
21	Xis-Tn	16356..16559 [+], 204	excisionase
22	Int-Tn	16641..17858 [+], 1218	transposase	Integrase

Gene may contribute to site-specific recombination

(1) Stegmann R et al. (2010). Antibiotic resistance profile of Staphylococcus rostri, a new species isolated from healthy pigs. Vet Microbiol. 145(1-2). [PubMed:20399039]

experimental literature