![]() | 307 |
![]() ![]() | Tn916(RST11) ![]() |
![]() ![]() | ICEO_0000259 |
![]() | Staphylococcus rostri RST11 |
![]() | 18032 |
![]() | 38.7 |
![]() | AT rich regions |
![]() | tetracycline resistance |
![]() | - |
![]() | FN550102 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..18032 |
![]() ![]() | coordinates: 2501..2633; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 2860..3849; Family: MOBT |
The graph information of Tn916(RST11) components from FN550102 | |||||
![]() | |||||
Complete gene list of Tn916(RST11) from FN550102 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 194..313 [+], 120 | hypothetical protein | ||
2 | - | 336..650 [+], 315 | conjugative transposon protein | ||
3 | - | 666..1052 [+], 387 | conjugative transposon protein | ||
4 | - | 1081..2466 [+], 1386 | hypothetical protein | Orf21_Tn, T4SS component | |
5 | - | 2860..3849 [+], 990 | putative transcriptional regulator | Relaxase, MOBT Family | |
6 | - | 3892..4113 [+], 222 | conjugative transposon protein | Orf19_Tn, T4SS component | |
7 | - | 4230..4727 [+], 498 | conjugative transposon protein | ||
8 | - | 4702..5208 [+], 507 | conjugative transposon protein | Orf17_Tn, T4SS component | |
9 | - | 5192..7639 [+], 2448 | putative regulatory protein | Orf16_Tn, T4SS component | |
10 | - | 7642..9819 [+], 2178 | putative membrane protein | Orf15_Tn, T4SS component | |
11 | - | 9816..10817 [+], 1002 | putative membrane protein | Orf14_Tn, T4SS component | |
12 | - | 10814..11746 [+], 933 | putative membrane protein | Orf13_Tn, T4SS component | |
13 | - | 12021..12107 [+], 87 | tetM leader peptide | ||
14 | tetM | 12108..14042 [+], 1935 | tetracycline resistance protein | AR | |
15 | - | 14140..14328 [+], 189 | putative transcriptional regulator | ||
16 | - | 14388..14741 [+], 354 | - | ||
17 | - | 14946..15017 [+], 72 | putative ATP-binding protein | ||
18 | - | 15195..15668 [+], 474 | putative regulatory protein | ||
19 | - | 15665..15895 [+], 231 | putative ATP-binding protein | ||
20 | - | 16121..16372 [-], 252 | excisionase | ||
21 | Xis-Tn | 16356..16559 [+], 204 | excisionase | ||
22 | Int-Tn | 16641..17858 [+], 1218 | transposase | Integrase |
(1) Stegmann R et al. (2010). Antibiotic resistance profile of Staphylococcus rostri, a new species isolated from healthy pigs. Vet Microbiol. 145(1-2). [PubMed:20399039] ![]() |
![]() |