ICEberg
I. Information of ICE
ICEberg ID306
Name Tn925 This ICE is derived from experimental literature
ICEO ID ICEO_0000258
OrganismEnterococcus faecalis plasmid pCF10
Size (bp)18032
GC content [Genome] (%)38.73[36.1]
Insertion siteAT rich regions
Function-
Species that ICE can be transferred to-
Nucleotide SequenceAY855841 (complete ICE sequence in this genome)
Replicon plasmid pCF10 (Taxonomy ID: 1351) [NC_006827]
Genome coordinates40068..58099 
Putative oriT region coordinates: 55467..55599;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of Tn925 is not available.

 

The gene information of Tn925 is not available.
ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins0Fasta
(1) Hirt H; Manias DA; Bryan EM; Klein JR; Marklund JK; Staddon JH; Paustian ML; Kapur V; Dunny GM (2005). Characterization of the pheromone response of the Enterococcus faecalis conjugative plasmid pCF10: complete sequence and comparative analysis of the transcriptional and phenotypic responses of pCF10-containing cells to pheromone induction. J Bacteriol. 187(3):1044-54. [PubMed:15659682] experimental
(2) Hedberg PJ; Leonard BA; Ruhfel RE; Dunny GM (1996). Identification and characterization of the genes of Enterococcus faecalis plasmid pCF10 involved in replication and in negative control of pheromone-inducible conjugation. Plasmid. 35(1):46-57. [PubMed:8693026] experimental
(3) Ruhfel RE; Manias DA; Dunny GM (1993). Cloning and characterization of a region of the Enterococcus faecalis conjugative plasmid, pCF10, encoding a sex pheromone-binding function. J Bacteriol. 175(16):5253-9. [PubMed:8349565] experimental
(4) Nakayama J; Ruhfel RE; Dunny GM; Isogai A; Suzuki A (1994). The prgQ gene of the Enterococcus faecalis tetracycline resistance plasmid pCF10 encodes a peptide inhibitor, iCF10. J Bacteriol. 176(23):7405-8. [PubMed:7545961] experimental
(5) Christie PJ; Korman RZ; Zahler SA; Adsit JC; Dunny GM (1987). Two conjugation systems associated with Streptococcus faecalis plasmid pCF10: identification of a conjugative transposon that transfers between S. faecalis and Bacillus subtilis. J Bacteriol. 169(6):2529-36. [PubMed:3034859] experimental
(6) Kao SM; Olmsted SB; Viksnins AS; Gallo JC; Dunny GM (1991). Molecular and genetic analysis of a region of plasmid pCF10 containing positive control genes and structural genes encoding surface proteins involved in pheromone-inducible conjugation in Enterococcus faecalis. J Bacteriol. 173(23):7650-64. [PubMed:1938961] experimental
(7) Torres OR; Korman RZ; Zahler SA; Dunny GM (1991). The conjugative transposon Tn925: enhancement of conjugal transfer by tetracycline in Enterococcus faecalis and mobilization of chromosomal genes in Bacillus subtilis and E. faecalis. Mol Gen Genet. 225(3):395-400. [PubMed:1850085] experimental
(8) Guffanti AA; Quirk PG; Krulwich TA (1991). Transfer of Tn925 and plasmids between Bacillus subtilis and alkaliphilic Bacillus firmus OF4 during Tn925-mediated conjugation. J Bacteriol. 173(5):1686-9. [PubMed:1847906] experimental
 
experimental experimental literature