I. Information of ICE

ICEberg ID	303
Name	Tn916(pAM120)
ICEO ID	ICEO_0000257
Organism	Cloning vector pAM120
Size (bp)	18032
GC content [Genome] (%)	38.75[38.53]
Insertion site	AT rich regions
Function	tetracycline resistance
Species that ICE can be transferred to	-
Nucleotide Sequence	U49939 (complete ICE sequence in this genome)
Replicon	[U49939]
Genome coordinates	1344..19375
Putative oriT region	coordinates: 3844..3976;   oriTDB id:  200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase	-

II. ICE interaction with IME/CIME/

The interaction information of Tn916(pAM120) is not available.

The graph information of Tn916(pAM120) components from U49939
Complete gene list of Tn916(pAM120) from U49939
#	Gene	Coordinates [+/-], size (bp)	Product  (GenBank annotation)	*Reannotation
1	-	13466..15385 [+], 1920	tetracycline resistance protein	AR
2	-	22297..23157 [-], 861	beta-lactamase

Flanking regions

(1) Gawron-Burke C; Clewell DB (1984). Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in Escherichia coli: strategy for targeting and cloning of genes from gram-positive bacteria. J Bacteriol. 159(1):214-21. [PubMed:6330031]

(2) Clewell DB; Flannagan SE; Ike Y; Jones JM; Gawron-Burke C (1988). Sequence analysis of termini of conjugative transposon Tn916. J Bacteriol. 170(7):3046-52. [PubMed:2838457]

experimental literature